ORFeome > 40789 – XORFeome 2.0

40789 – XORFeome 2.0

General Information

Species: Xenopus tropicalis sept3 protein, mRNA (cDNA clone MGC:69255 IMAGE:5308112), complete cds
Gene Symbol: 40789
Gene ID: 594940
ORF gb_acc: MG134269
ORF ID: 11936

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC090575

Library Location

Plate ID: GDExt11019
Well Location: D04

EST Sequences

Clone: MGC:69255 IMAGE:5308112
Trimmed Sequence: ATGGAGGAGCAGAACCTCGCCCGGCCCGAGCCGGAGCCCCAGAGATGCGGCGACATTGGCCAGGAGCCCATCGGATACGTGGGCATCGACGCCGTGCTGGACCAGATGAGACGCAAAGCCATGAAAAATGGCTTTGAGTTCAACATTATGGTGGTGGGACAGAGCGGTCTGGGGAAATCCACCCTAGTGAACACTCTTTTCAAGTCCAAAGTGATCCGGAAATCTCCCGGCGCCACCATACCCAAAACCGTGGAACTGAACGCAGTCAGCCAAGTGGTCGAGGAGAGGGGCATGGAGATGAGACTCACTGTAATCGACACGCCGGGATTCGGCGACCAGATCAACAATCAGAACTGCTGGGACCCCATCATTAAGTACATACATGAGCAGTACGAGAAGTACCTGAGGGAGGAAATTCTCATCAACCGCAAGCGCCGCATCCCTGACTCTCGGATCCACAGCTGTATCTACTTCATCCCCCCCACGGGCCACTGGCTGAGACCTCTGGACTTGGAGTTCATGAAGCGATTGGGCCGGATTGTGAACGTGGTGCCGGTGATCGCTAAAGCAGATACTCTCACCTTGGAAGAGAGGGAGGAATTCAAACAGAGGATACGGAAGGACCTACAGACCCACGGTATCAGCGTGTACCCACAGCCAGAGCTGGATGAAGACCCAGTGGATGCCTTAGTGAATGACAAAATTCGGGAGAAGATTCCATTCGCTGTGGTGGGAACAGATGAGGAGCATCAGGTGAACGGCAGGAAAGTCCTGGGCAGAAAGACCAAGTGGGGAGTCATAGAAGTTGAGAACACGGCACACTGTGAATTTGCCAACCTCCGGGATCTGCTTATCCGATCCAACCTGCAGGACCTTAAAGACATAACCCACAACATCCACTATGAGACCTACAGGGTCAGTCGGCTGAACGAGAAATTCCAGTCATCACAGACAAAAGAGGTGGGGGTTTTGTGA
Full Trace Sequence: gtacggcagcccagcatctccaggccggcaccgtttggtgggacactgcccaagggggcaccgggggctccatgtagaaaggaaaggacaggagagtctggtcccagcttagcacggttagaagaagaggctctgagctcggccccagggaagccttcagtcacagcaggatggaggagcagaacctcgcccggcccgagccggagccccagagatgcggcgacattggccaggagcccatcggatacgtgggcatcgacgccgtgctggaccagatgagacgcaaagccatgaaaaatggctttgagttcaacattatggtggtgggacagagcggtctggggaaatccaccctagtgaacactcttttcaagtccaaagtgatccggaaatctcccggcgccaccatacccaaaaccgtggaactgaacgcagtcagccaagtggtcgaggagaggggcatggagatgagactcactgtaatcgacacgccgggattcggcgaccagatcaacaatcagaactgctgggaccccatcattaagtacatacatgagcagtacgagaagtacctgagggaggaaattctcatcaaccgcaagcgccgcatccctgactctcggatccacagctgtatctacttcatcccccccacgggccactggctgagacctctggacttggagttcatgaagcgattgggccggattgtgaacgtggtgccggtgatcgctaaagcagatactctcaccttggaagagagggaggaattcaaacagaggatacggaaggacctacagacccacggtatcagcgtgtacccacagccagagctggatgaagacccagtggatgccttagtgaatgacaaaattcgggagaagattccattcgctgtggtgggaacagatgaggagcatcaggtgaacggcaggaaagtcctgggcagaaagaccaagtggggagtcatagaagttgagaacacggcacactgtgaatttgccaacctccgggatctgcttatccgatccaacctgcaggaccttaaagacataacccacaacatccactatgagacctacagggtcagtcggctgaacgagaaattccagtcatcacagacaaaagaggtgggggttttgtgagccctctcccaggatcccgagaccgacaatgtgcctccagactggatcattatagtccagccaatatggaaccagctgactgccaggccactcctacagggaaatgaactcttatccactgtatagggaaacagacttgatccatcgcattggtcagagcatttactgcatgcagcctgtctgtccacaggcaaaaaacgtaatgcacatctatctgtaagggaaacacattctattgcctatctatgccacaggcccaggcaagcaaatctactgcctatctatcctatctacaaacaactctgtgtcacagggccaggcaaacaaatctactgcctatctatcctatctacaaacaactctgtgtcacagggccaggcaagcaaatctactgcctatctatcctatctacaaacaactctgtgtcacagggccaggcaagcaaatctactgcctatctatcctatctgcaaacgactctgtctcacagggccaggcaaacaaatctactgcctatctatcctatctacaaacaactctgtgtcacagggccaggcaaacaaatctactgcctatctatcctatctgcaaacgactctgtctcacagggccaggcaaacaaatctactgcctatctatcctatctacaaacgactctgtctcacaggcccaggcaagcaaatctactgcctatctatcctatctgcaaacgactctgtctcacagggccaggcaaacaaatctactgcctatctatcctatctgcaaacgactctgtctcacagggccaggcaaacaaatctactgcctatctatcctatctgcaaacgactctgtctcacagggccaggcaaacaaatctactgcctatatatcctatctgcaaacaaatctgtctcacaggcccaggcaagcaaatctactgactatctatcctatctacaaacgtctcacaaggccagacaaatcaatttaaccgtccatgtattttacagtggaagaactcttccacgggcaaacaaatacactgcctatctattgtacagggaaacaattctactgcctatcagttcatcaggcaaactattctactgcctatctgttgttcagtgaacgtaaactaaggtctattcattcttcaggcaaactattctactgcctatctgttctacagggaaagtaagctactcctatccattcttcaggcaaactaatctatctcaagggcaattcttcttccagtttatagacttcaggttgctctgaaggcagttaggtgagatttggagagaatgtctattatctgttccagatacccctgcaagctcagctagaaggccagttagggtaagatttgaagagaatgtctattctctctctcccagatacccctgcgagctcagctagaaggccaattagggtgagatttgaagagaatgtctattctctctctcccagatacccctgcgagctcagctagaaggccaattagggtgagatttggggagaatgtctatttgctttttgagataccactgaaagcaccaattagaaggctaattaaggtgagattggggagaatgtctgtttactctcctagataccctagaaggccagttagggtgagatttagtgaaaacatctcttctttctcttgaatacccaattagaatttgagttagggtaagataggggagaatgtctatttgctctcctactgtagatacccctggaagaccaattagggtgagatttggggagaatgtctatttgctctcctatagaccaaagcctagctagaagccagttggggtgagatttagggagaacacctcttctttctcttaaatgcccttgaaaactcaagtagaaagtgagttagggtaagattgggaagaatgtctatttgctctcctagatgcccctgaaagcaccaactggaaggccaattagggtgagattgggggagaatgtctatttgctcccctagaaaccattgaaagcctagctagaaggccagttagggtaagattgaggagaatgtctatttgctgtcctagatacccctgaaagcaccaactggaaggccaattagggtgcgattgggggagaatgtctatttgctcccctagaaaccattgaaagcccagctagaaggctagttagggtaagattgaggagaatgtcttatttgctttcctagtaacccaaaagcccagctagaaggctagttaggttggattttgggtgaaaatatgtttgctgtcccagatattcttgtatattttatgttatgagcaaaggggggccctgaacaaagattagtcgcccaaagggacatgaactgatctgcccagcaacaaacttatcaccctattcatgcccaatcaaatcagcaccccgtggggcaatgtcactgatccaacataaggccatccctgaaccgactcagcaccacaccttgttgccacctcactagccgccacaccagtatccctatcggcctatggcactgcagaatgttgtataggtactagttttttttaaaagaattaaaattttttatcaagaataaacaaccgcgacaaaccggcggagcaccggcgagaccagcaggcgatccagatttggttctggtacccccagcgacacgatggagagatggagacagtgccggtctatggggggggatgagagactgataggaagaagatgtttatatataatgtaccgatgtatttacagaataaggcacgctctcaccgccatttcctatctatactctattgggtccatattttatcaaagcttttttttgtataacgttggtgtttcagcgtctggaatcctctataaataaacgcctttcagacctaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MEEQNLARPEPEPQRCGDIGQEPIGYVGIDAVLDQMRRKAMKNGFEFNIMVVGQSGLGKSTLVNTLFKSKVIRKSPGATIPKTVELNAVSQVVEERGMEMRLTVIDTPGFGDQINNQNCWDPIIKYIHEQYEKYLREEILINRKRRIPDSRIHSCIYFIPPTGHWLRPLDLEFMKRLGRIVNVVPVIAKADTLTLEEREEFKQRIRKDLQTHGISVYPQPELDEDPVDALVNDKIREKIPFAVVGTDEEHQVNGRKVLGRKTKWGVIEVENTAHCEFANLRDLLIRSNLQDLKDITHNIHYETYRVSRLNEKFQSSQTKEVGVL
Donor tissue: gastrula