ORFeome > abi1 – XORFeome 2.0

abi1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis abl-interactor 1, mRNA (cDNA clone MGC:79488 IMAGE:6976689), complete cds
Gene Symbol: abi1
Gene ID: 493216
ORF gb_acc: MG133569
ORF ID: 11102

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC079926

Library Location

Plate ID: GDExt11010
Well Location: C06

EST Sequences

Clone: MGC:79488 IMAGE:6976689
Trimmed Sequence: ATGGCTGAGCTACAGATGTTACTAGAGGAGGAGATCCCCGCCGGGAAGAAAGCTCTGATCGAGAGCTTCCACAACCTGACCCGGGTGGCCGACTACTGCGAGTCCAACTATATCCAGGCTCCTGATAAGAGGAAAGCATTAGAAGAAACAAAGGCATACACAACTCAGTCTCTGGCAAGTGTTGCCTATCAGATCAATGCACTGGCCAACAATGTGCTCCAGCTATTGGATATTCAAGCCTCCCAGCTGCGGAGAATGGAGTCCTCCATCAACCATATCTCCCAGACTGTGGATATTCATAAAGAAAAGGTGGCTCGCAGAGAGATCGGTATCTTAACAACCAATAAGAACACTGCAAGGAGTCACAAAATCATTGCTCCCGCTAACATGGAGCGCCCCGTCAGGTACATTCGAAAACCCATAGACTACACGGTGCTGGATGATGTAGGCCATGGAGTAAAGCATGGAGGAAATCAGGCCGCAAGAACGGGCACGTTGACTAGAACCAATCCTCCCACGCAGAAGCCTCCCAGCCCCCCAATGCCTGGTCGAGGTACTTTGGGGCGGAACACCCCATACAAAACCCTGGAGCCTGTAAAGCCTCCGACTGTTCCAAATGATTACATGACGAGCCCAGCTAGGCTTGGCAGCCAACACAGTCCTGGAAGAACAGCATCGCTCAACCAGAGACCGAGAACACACAGTGGCAGCAGCGGCGGAAGTGGCAGCAGAGAGAACAGCGGAAGCAGCAGTATTGGGATTCCCATTGCTGTACCTACACCGTCTCCTCCAACTATTGGACAAGTGGGCACAGGCTCAGCACCGGGTTCCCAGTTTGGCTCAATGACCAGGCAGATCTCTCGGCACAACTCCACCACTTCCTCTGCTTCTTCTGGTGGCTACAGACGGACTCCTTCTGTGACTTCTCAGTTCTCTGGCCAACCTCATGTCAACGGCGGGCCTCTGTATTCTCAAAACTCAATTTCTATCGCTTCTCCCCCTCCCCCCATGCCTCAATTGACTCCACAGATCCCTCTCACAGGCTTCGTGGCCAGGGTGCAGGAAAACATTGCGGACAGTCCAACACCACCACCACCTCCACCTCCTGATGAGATCCCCATGTTCGATGATTCTCCTCCTCCACCTCCGCCACCTCCAGTTGATTATGAAGAAGAAGAAGCTGCAGTGGTGCAGTACAATGATCCCTACGCCGACGGAGACCCTATTTGGGCACCCAAGTCCTATCTTGAGAAAGTTGTTGCCATTTATGACTATTCAAAAGACAAAGAAGATGAGCTGTCATTTATGGAGGGAGCCATTATTTACGTTATAAAGAAGAATGACGACGGCTGGTATGAAGGGGTCTCCAACGGAGTAACCGGCCTCTTCCCTGGCAATTACGTAGAAACAGTCATGCACTATGCAGATTAA
Full Trace Sequence: ccaggcttgagcaggcaggcagcctggcgggtgtggacttagctgttcttccctcagtgtaaaaggaggaagcgatgcgcagggctggaagatggctgagctacagatgttactagaggaggagatccccgccgggaagaaagctctgatcgagagcttccacaacctgacccgggtggccgactactgcgagtccaactatatccaggctcctgataagaggaaagcattagaagaaacaaaggcatacacaactcagtctctggcaagtgttgcctatcagatcaatgcactggccaacaatgtgctccagctattggatattcaagcctcccagctgcggagaatggagtcctccatcaaccatatctcccagactgtggatattcataaagaaaaggtggctcgcagagagatcggtatcttaacaaccaataagaacactgcaaggagtcacaaaatcattgctcccgctaacatggagcgccccgtcaggtacattcgaaaacccatagactacacggtgctggatgatgtaggccatggagtaaagcatggaggaaatcaggccgcaagaacgggcacgttgactagaaccaatcctcccacgcagaagcctcccagccccccaatgcctggtcgaggtactttggggcggaacaccccatacaaaaccctggagcctgtaaagcctccgactgttccaaatgattacatgacgagcccagctaggcttggcagccaacacagtcctggaagaacagcatcgctcaaccagagaccgagaacacacagtggcagcagcggcggaagtggcagcagagagaacagcggaagcagcagtattgggattcccattgctgtacctacaccgtctcctccaactattggacaagtgggcacaggctcagcaccgggttcccagtttggctcaatgaccaggcagatctctcggcacaactccaccacttcctctgcttcttctggtggctacagacggactccttctgtgacttctcagttctctggccaacctcatgtcaacggcgggcctctgtattctcaaaactcaatttctatcgcttctccccctccccccatgcctcaattgactccacagatccctctcacaggcttcgtggccagggtgcaggaaaacattgcggacagtccaacaccaccaccacctccacctcctgatgagatccccatgttcgatgattctcctcctccacctccgccacctccagttgattatgaagaagaagaagctgcagtggtgcagtacaatgatccctacgccgacggagaccctatttgggcacccaagtcctatcttgagaaagttgttgccatttatgactattcaaaagacaaagaagatgagctgtcatttatggagggagccattatttacgttataaagaagaatgacgacggctggtatgaaggggtctccaacggagtaaccggcctcttccctggcaattacgtagaaacagtcatgcactatgcagattaaaactcacatttaaaagggaaaaaaaaaaaaaaaaaaa
Translation: MAELQMLLEEEIPAGKKALIESFHNLTRVADYCESNYIQAPDKRKALEETKAYTTQSLASVAYQINALANNVLQLLDIQASQLRRMESSINHISQTVDIHKEKVARREIGILTTNKNTARSHKIIAPANMERPVRYIRKPIDYTVLDDVGHGVKHGGNQAARTGTLTRTNPPTQKPPSPPMPGRGTLGRNTPYKTLEPVKPPTVPNDYMTSPARLGSQHSPGRTASLNQRPRTHSGSSGGSGSRENSGSSSIGIPIAVPTPSPPTIGQVGTGSAPGSQFGSMTRQISRHNSTTSSASSGGYRRTPSVTSQFSGQPHVNGGPLYSQNSISIASPPPPMPQLTPQIPLTGFVARVQENIADSPTPPPPPPPDEIPMFDDSPPPPPPPPVDYEEEEAAVVQYNDPYADGDPIWAPKSYLEKVVAIYDYSKDKEDELSFMEGAIIYVIKKNDDGWYEGVSNGVTGLFPGNYVETVMHYAD
Donor tissue: tailbud