ORFeome > actb – XORFeome 2.0

actb – XORFeome 2.0

General Information

Species: Xenopus tropicalis actin, beta, mRNA (cDNA clone MGC:79692 IMAGE:6980855), complete cds
Gene Symbol: actb
Gene ID: 407952
ORF gb_acc: MG133687
ORF ID: 11242

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC082343

Library Location

Plate ID: GDExt11012
Well Location: C12

EST Sequences

Clone: MGC:79692 IMAGE:6980855
Trimmed Sequence: ATGGACGACGATATTGCTGCACTGGTCGTTGACAATGGTTCTGGTATGTGCAAAGCCGGCTTTGCAGGTGATGATGCACCCCGTGCTGTTTTCCCATCCATTGTTGGTCGCCCAAGACATCAGGGTGTCATGGTTGGAATGGGACAGAAAGATAGCTACGTAGGAGACGAAGCTCAAAGCAAAAGAGGTATTCTTACACTCAAATATCCTATTGAGCATGGCATTGTCACTAACTGGGATGATATGGAGAAGATCTGGCATCATACCTTCTACAATGAACTCAGAGTGGCCCCAGAGGAACACCCAGTGCTGCTGACAGAAGCACCCTTGAATCCCAAAGCTAACCGGGAGAAAATGACGCAGATCATGTTTGAGACCTTTAACACTCCAGCTATGTATGTTGCCATCCAAGCTGTGTTGTCCCTGTATGCATCTGGTCGTACCACTGGTATTGTCATGGACTCAGGTGATGGTGTAACACACACTGTGCCAATATATGAAGGTTATGCTCTACCCCATGCCATTCTGCGTCTGGACTTGGCTGGACGTGACCTGACAGACTACCTCATGAAAATCCTCACTGAGAGGGGGTACAGCTTCACCACCACAGCTGAAAGAGAAATTGTTCGTGATATCAAGGAGAAATTGTGCTATGTTGCTCTGGACTTTGAGCAGGAGATGGCCACAGCTGCTTCTTCTTCATCATTGGAAAAGAGTTATGAGCTGCCTGATGGACAAGTTATCACCATTGGTAATGAGCGGTTTAGATGTCCAGAAGCACTCTTCCAGCCTTCTTTCCTTGGTATGGAATCCTGTGGCATTCATGAAACCACTTACAACTCAATTATGAAGTGTGATGTAGATATCCGTAAGGACCTCTATGCCAATACTGTTCTCTCTGGTGGAACCACAATGTACCCTGGAATTGCTGATAGAATGCAGAAAGAAATAACTGCACTAGCTCCCAGCACCATGAAAATCAAGATAATTGCTCCCCCTGAGCGTAAATACTCTGTCTGGATTGGCGGTTCCATCTTGGCTTCCCTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGATGAGTCTGGGCCCTCAATAGTGCATCGTAAATGCTTCTAA
Full Trace Sequence: aggacagtgtgtgtgtcgtactctcagattacaatggacgacgatattgctgcactggtcgttgacaatggttctggtatgtgcaaagccggctttgcaggtgatgatgcaccccgtgctgttttcccatccattgttggtcgcccaagacatcagggtgtcatggttggaatgggacagaaagatagctacgtaggagacgaagctcaaagcaaaagaggtattcttacactcaaatatcctattgagcatggcattgtcactaactgggatgatatggagaagatctggcatcataccttctacaatgaactcagagtggccccagaggaacacccagtgctgctgacagaagcacccttgaatcccaaagctaaccgggagaaaatgacgcagatcatgtttgagacctttaacactccagctatgtatgttgccatccaagctgtgttgtccctgtatgcatctggtcgtaccactggtattgtcatggactcaggtgatggtgtaacacacactgtgccaatatatgaaggttatgctctaccccatgccattctgcgtctggacttggctggacgtgacctgacagactacctcatgaaaatcctcactgagagggggtacagcttcaccaccacagctgaaagagaaattgttcgtgatatcaaggagaaattgtgctatgttgctctggactttgagcaggagatggccacagctgcttcttcttcatcattggaaaagagttatgagctgcctgatggacaagttatcaccattggtaatgagcggtttagatgtccagaagcactcttccagccttctttccttggtatggaatcctgtggcattcatgaaaccacttacaactcaattatgaagtgtgatgtagatatccgtaaggacctctatgccaatactgttctctctggtggaaccacaatgtaccctggaattgctgatagaatgcagaaagaaataactgcactagctcccagcaccatgaaaatcaagataattgctccccctgagcgtaaatactctgtctggattggcggttccatcttggcttccctgtccaccttccagcagatgtggatcagcaagcaggagtatgatgagtctgggccctcaatagtgcatcgtaaatgcttctaaaaggacggaccctttcaacgtgaacaaatgtacctgtgcaggaagataacattggcatggcttttctttcattggcgcttggctcagatttgataactggaatgaacaaatagcactgtatggtcatcaatgcagaggacattatgattttattcagtcaatagtattgtattgaggaagctaccctttcaatgttgcccagcttggtgggaagctcatacagaaatcatggtgatactattgtgttttttgatttttttttttttttgttttttttttcttgtgcagctatgtacccaaacatgtctctgtatcttctgccttgaacacttgtaacttgtttaacccaaaaaagggcatcattctctaacacctggaaggtttacattatcattgatcacataagatgtgacgggtcacctgtaacctaactgaaaaaaataaaaccaagttgtttcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDDDIAALVVDNGSGMCKAGFAGDDAPRAVFPSIVGRPRHQGVMVGMGQKDSYVGDEAQSKRGILTLKYPIEHGIVTNWDDMEKIWHHTFYNELRVAPEEHPVLLTEAPLNPKANREKMTQIMFETFNTPAMYVAIQAVLSLYASGRTTGIVMDSGDGVTHTVPIYEGYALPHAILRLDLAGRDLTDYLMKILTERGYSFTTTAEREIVRDIKEKLCYVALDFEQEMATAASSSSLEKSYELPDGQVITIGNERFRCPEALFQPSFLGMESCGIHETTYNSIMKCDVDIRKDLYANTVLSGGTTMYPGIADRMQKEITALAPSTMKIKIIAPPERKYSVWIGGSILASLSTFQQMWISKQEYDESGPSIVHRKCF
Donor tissue: tailbud