ORFeome > actr2 – XORFeome 2.0

actr2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ARP2 actin-related protein 2 homolog, mRNA (cDNA clone MGC:69469 IMAGE:5336079), complete cds
Gene Symbol: actr2
Gene ID: 594957
ORF gb_acc: MG134247
ORF ID: 11908

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC090611

Library Location

Plate ID: GDExt11018
Well Location: A12

EST Sequences

Clone: MGC:69469 IMAGE:5336079
Trimmed Sequence: ATGGACAGCCAAGGCAGGAAGGTAGTGGTGTGCGACAACGGCACCGGGTTTGTAAAATGTGGATATGCCGGCTCAAACTTTCCAGAGCACATCTTCCCGGCTTTGGTTGGGCGACCTGTGATCCGATCTACTGCCAAAGTGGGAAACATTGAGATTAAGGATCTGATGGTCGGTGATGAAGCCAGCGAGTTGCGTTCAATGCTGGAAGTGAACTACCCCATGGAGAATGGTATAGTGCGGAATTGGGATGATATGAAGCACCTTTGGGACTATACCTTTGGACCAGAAAAACTGAACATAGACACCAGAGACTGTAAAATCCTGCTTACAGAGCCCCCCATGAATCCAACTAAAAACCGTGAAAAGATTGTTGAGGTAATGTTTGAGACCTACCAGTTCTCCGGTGTGTATGTAGCAATACAGGCCGTACTCACATTATACGCACAAGGTCTCTTGACTGGTGTTGTGGTTGATTCTGGAGATGGTGTCACACACATCTGCCCTGTGTACGAAGGCTTCTCTCTGCCTCACCTCACCAGGAGACTAGATATTGCAGGCAGGGATATCACCCGCTACCTTATAAAGTTGCTCTTACTACGAGGGTATGCTTTCAACCACTCTGCTGATTTTGAGACTGTTCGTATGATCAAGGAGAAGCTTTGCTATGTGGGATACAACATTGAACAGGAGCAGAAACTTGCGCTAGAGACAACAGTCCTTGTGGAGTCTTACACACTTCCAGATGGCAGGGTTATTAAAGTTGGTGGAGAGCGTTTTGAGGCACCAGAAGCTCTGTTCCAGCCCCATCTTATCAATGTAGAAGGCGTTGGCGTTGCTGAATTGCTGTTCAACACCATTCAGGCAGCTGACATTGATACTCGGCCAGAGTTCTATAAGCACATTGTGCTGTCAGGGGGCTCCACAATGTATCCAGGATTGCCCTCCCGTTTAGAGCGAGAACTGAAACAGCTCTATCTGGAGCGAGTCCTGAAAGGAGATGTTGAAAAATTATCGAAATTTAAGATCCGCATTGAAGATCCTCCCCGCCGCAAGCACATGGTGTTCTTGGGTGGAGCAGTATTAGCTGACATCATGAAAGACAAAGACAACTTCTGGATGACGCGCCAAGAGTACCAAGAGAAAGGCACGCGTGTTCTGGAGAAACTTGGTGTGACTGTACGATAA
Full Trace Sequence: gcagaagtggtggtgcctgggcggtgggcgcacttccggtctattgactgactgatagattgctctcaggctccggtgccggcggaggagggaaacaacataatggacagccaaggcaggaaggtagtggtgtgcgacaacggcaccgggtttgtaaaatgtggatatgccggctcaaactttccagagcacatcttcccggctttggttgggcgacctgtgatccgatctactgccaaagtgggaaacattgagattaaggatctgatggtcggtgatgaagccagcgagttgcgttcaatgctggaagtgaactaccccatggagaatggtatagtgcggaattgggatgatatgaagcacctttgggactatacctttggaccagaaaaactgaacatagacaccagagactgtaaaatcctgcttacagagccccccatgaatccaactaaaaaccgtgaaaagattgttgaggtaatgtttgagacctaccagttctccggtgtgtatgtagcaatacaggccgtactcacattatacgcacaaggtctcttgactggtgttgtggttgattctggagatggtgtcacacacatctgccctgtgtacgaaggcttctctctgcctcacctcaccaggagactagatattgcaggcagggatatcacccgctaccttataaagttgctcttactacgagggtatgctttcaaccactctgctgattttgagactgttcgtatgatcaaggagaagctttgctatgtgggatacaacattgaacaggagcagaaacttgcgctagagacaacagtccttgtggagtcttacacacttccagatggcagggttattaaagttggtggagagcgttttgaggcaccagaagctctgttccagccccatcttatcaatgtagaaggcgttggcgttgctgaattgctgttcaacaccattcaggcagctgacattgatactcggccagagttctataagcacattgtgctgtcagggggctccacaatgtatccaggattgccctcccgtttagagcgagaactgaaacagctctatctggagcgagtcctgaaaggagatgttgaaaaattatcgaaatttaagatccgcattgaagatcctccccgccgcaagcacatggtgttcttgggtggagcagtattagctgacatcatgaaagacaaagacaacttctggatgacgcgccaagagtaccaagagaaaggcacgcgtgttctggagaaacttggtgtgactgtacgataaacacaactgccatttcccatcgcttctctaaagctttccttgtttcctttattgccaatctctgaactcattcagttccatgactttcttggaaaggcctgtctgtgtccttttgacctaaagatgggagttttttttgccctgtttcctgaggagagctttgttccatgtttgttaatgtacctcggtttgactatttaatatgccgtgtctttacaaacacaaagctctaaccacagagcctaactgctccacattgtccgttctcgttagacatttggccaatcacagtaggcttttccatctagtgtactgctctaaggctgctagctttatcttctactcaccgggtggtttgccttttgtttctataagagaatcctttaaaagcagcttttaataccatatccttgggatggaccctttttttttttcctttttttccacattagccttctcgtacacaaaaaaaaatctagattttttttttaagcagttatcggtaattgtgatttattttgtacaacaatttacaaatccctctgctgctttctgtcactttagttataaaatctaaatttttgttttaattttttttgtttccatgtttcattcttagaaggtacacttctacacagtcatgtctgttgttagggcgcagcattagtgtgaaggaggtcctttgcccatattgtgtgataatcattgttaggcatcacttacatatagtaactcagtggccctccagctgctgttgaacttacccaactgctaaaggctgccagggttttgtggggatgtagttcttcagcagccagaggtgccctgatttaaatggttttatccccccttctttgctgtgggcctcatccagccctgcaaacagcaccatgtaacatgggaattgctggactttttttctttttgccttttaatgaagcacttgatcaggtgacccattccactgggaacaagctcattgacaagaaattatcagaacagttaaaaagttacaaatgtgtttgtgattattccaacaaaatctagagaattcctatctatctatgaatttcttttgttttattgttttcctttgtgcgctcgtttctatagaagcgcagtgaataaatttgctgttgctgtaagacagtgccaagtgcgattcttccaagaggaatgttcccaagacaaaataaatgacatataatggttatctaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDSQGRKVVVCDNGTGFVKCGYAGSNFPEHIFPALVGRPVIRSTAKVGNIEIKDLMVGDEASELRSMLEVNYPMENGIVRNWDDMKHLWDYTFGPEKLNIDTRDCKILLTEPPMNPTKNREKIVEVMFETYQFSGVYVAIQAVLTLYAQGLLTGVVVDSGDGVTHICPVYEGFSLPHLTRRLDIAGRDITRYLIKLLLLRGYAFNHSADFETVRMIKEKLCYVGYNIEQEQKLALETTVLVESYTLPDGRVIKVGGERFEAPEALFQPHLINVEGVGVAELLFNTIQAADIDTRPEFYKHIVLSGGSTMYPGLPSRLERELKQLYLERVLKGDVEKLSKFKIRIEDPPRRKHMVFLGGAVLADIMKDKDNFWMTRQEYQEKGTRVLEKLGVTVR
Donor tissue: tailbud