ORFeome > adrm1 – XORFeome 2.0

adrm1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis adhesion regulating molecule 1, mRNA (cDNA clone MGC:75897 IMAGE:5383443), complete cds
Gene Symbol: adrm1
Gene ID: 394646
ORF gb_acc: MG133020
ORF ID: 10409

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061352

Library Location

Plate ID: GDExt11004
Well Location: E08

EST Sequences

Clone: MGC:75897 IMAGE:5383443
Trimmed Sequence: ATGTCGTCCGGAGCGCTGTTTCCCAGTTTGGTCCCCGGCTCTCGGGGTTCCTCCAGCAAATACCTCGTGGAGTTCCGAGCCGGCAAAATGTCCCTAAAGGGCAGCACGGTGACGCCGGACAAAAGGAAGGGTCTCGTTTACATCCAGCAAACGGACGACTCTCTCATTCACTTCTGCTGGAAGGACAGAACATCAGGCAGCGTGGAGGATGATCTGATCATCTTTCCAGACGACTGTGAGTTCAAGAGAGTGTCGCAGTGCACCACGGGGCGCGTGTATGTGCTCAAGTTCAAGGCCGGCTCCAAGAGGCTCTTTTTCTGGATGCAGGAGCCCAAGACTGATAAGGACGAGGAATATTGCAGAAAGGTTAACGAGTATCTAAATAACCCGCCAATGCCCGGCGCCCTTGGGGGAAGTGGCAGCGGTGGCCACGAACTTTCTGCCCTGGGAGGAGAAGGTGGATTGCAAAGCCTGCTGGGAAACATGAGCCATAACCAACTCATGCAGCTGATCGGGCCCACTGGACTCGGAGGACTCGGGGGGCTTGGAGCTTTAACTGGACCAGGATTGGCCAGTCTGTTGGGCAGCGGTGGACCCACAACAAGCAGTTCTTCTTCCAGTTCTCGCAGCCAATCGGCAGCTGTCACTCCATCGTCCACAACATCCTCAACACGAACAACGTCTGCCCCTGCTGCTCCGGCTGCAGCACCGGCCACAACCCCAAGCCCGGCTGTCAGCTCCAATGACGGGGCCAGTGCAGCGACTAGCCCCACCCAGCCTATTCAGCTGAGTGACCTGCAGAACATCTTGGCCACGATGAATGTCCCTGCCACAGGGGAAGGAGGCCAGCAAGTGGATCTTGCCAGTGTTCTCACCCCAGAGATTATGGCTCCAATCCTGGCTAATGCTGAAGTCCAGGAGAGACTGATGCCTTACCTTCCATCAGGGGAATCCCTTCCTCAGACAGCAGATGAGATCCAGAACACACTAACCTCCCCACAGTTTCAGCAGGCTCTGAGTATGTTTAGTGCGGCGCTGGCATCCGGACAGCTGGGACCACTGATGAGTCAGTTTGGCCTGCCTGCAGATGCCGTAGATGCAGCCAATAAAGGAGATATCGAGGCCTTCGCCAAAGCGATGCAGACCACATCCTCGCAAAAGGAGCGAGAGTCCAGCGAGAAGAAAGAGGAGGAGGAGGATATGAGCTTAGATTAA
Full Trace Sequence: gtttcatttgagaggttcggagcggattaagaatgtcgtccggagcgctgtttcccagtttggtccccggctctcggggttcctccagcaaatacctcgtggagttccgagccggcaaaatgtccctaaagggcagcacggtgacgccggacaaaaggaagggtctcgtttacatccagcaaacggacgactctctcattcacttctgctggaaggacagaacatcaggcagcgtggaggatgatctgatcatctttccagacgactgtgagttcaagagagtgtcgcagtgcaccacggggcgcgtgtatgtgctcaagttcaaggccggctccaagaggctctttttctggatgcaggagcccaagactgataaggacgaggaatattgcagaaaggttaacgagtatctaaataacccgccaatgcccggcgcccttgggggaagtggcagcggtggccacgaactttctgccctgggaggagaaggtggattgcaaagcctgctgggaaacatgagccataaccaactcatgcagctgatcgggcccactggactcggaggactcggggggcttggagctttaactggaccaggattggccagtctgttgggcagcggtggacccacaacaagcagttcttcttccagttctcgcagccaatcggcagctgtcactccatcgtccacaacatcctcaacacgaacaacgtctgcccctgctgctccggctgcagcaccggccacaaccccaagcccggctgtcagctccaatgacggggccagtgcagcgactagccccacccagcctattcagctgagtgacctgcagaacatcttggccacgatgaatgtccctgccacaggggaaggaggccagcaagtggatcttgccagtgttctcaccccagagattatggctccaatcctggctaatgctgaagtccaggagagactgatgccttaccttccatcaggggaatcccttcctcagacagcagatgagatccagaacacactaacctccccacagtttcagcaggctctgagtatgtttagtgcggcgctggcatccggacagctgggaccactgatgagtcagtttggcctgcctgcagatgccgtagatgcagccaataaaggagatatcgaggccttcgccaaagcgatgcagaccacatcctcgcaaaaggagcgagagtccagcgagaagaaagaggaggaggaggatatgagcttagattaaagccagggcacactttgtgccagccaagcacaaatgctttatcccccagctctgcgtcccacacacgtatgttcttttcagcgttgaataaatattccctttgctgctaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSSGALFPSLVPGSRGSSSKYLVEFRAGKMSLKGSTVTPDKRKGLVYIQQTDDSLIHFCWKDRTSGSVEDDLIIFPDDCEFKRVSQCTTGRVYVLKFKAGSKRLFFWMQEPKTDKDEEYCRKVNEYLNNPPMPGALGGSGSGGHELSALGGEGGLQSLLGNMSHNQLMQLIGPTGLGGLGGLGALTGPGLASLLGSGGPTTSSSSSSSRSQSAAVTPSSTTSSTRTTSAPAAPAAAPATTPSPAVSSNDGASAATSPTQPIQLSDLQNILATMNVPATGEGGQQVDLASVLTPEIMAPILANAEVQERLMPYLPSGESLPQTADEIQNTLTSPQFQQALSMFSAALASGQLGPLMSQFGLPADAVDAANKGDIEAFAKAMQTTSSQKERESSEKKEEEEDMSLD
Donor tissue: neurula