ORFeome > ap2a2 – XORFeome 2.0

ap2a2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis adaptor-related protein complex 2, alpha 2 subunit, mRNA (cDNA clone MGC:69489 IMAGE:5336288), complete cds
Gene Symbol: ap2a2
Gene ID: 407867
ORF gb_acc: MG133409
ORF ID: 10919

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067918

Library Location

Plate ID: GDExt11009
Well Location: D03

EST Sequences

Clone: MGC:69489 IMAGE:5336288
Trimmed Sequence: ATGCCTGCCGTGTCTAAAGGGGATGGGATGCGGGGCCTGGCCGTGTTCATATCAGACATCAGAAACTGCAAAAGTAAAGAAGCAGAAATAAAGAGAATAAACAAAGAGCTGGCCAATATTCGTTCCAAGTTCAAGGGAGACAAAGCTCTAGATGGCTATAGCAAGAAGAAATATGTCTGCAAGCTGCTCTTTATCTTTCTGCTGGGCCATGACATTGACTTTGGACACATGGAGGCAGTAAATCTGCTGAGCTCCAACAAGTACACAGAGAAGCAGATTGGCTACCTTTTTATCTCTGTGCTGGTGAACTCTAACAGCGAGCTTATTAGGCTCATCAACAATGCCATCAAGAACGACCTGTCAAGCCGCAACCCCACCTTTATGGGCCTTGCCCTGCACTGCATTGCTAATGTGGGTAGCCGAGAAATGGCTGAGGCATTTGCTGGTGAGATCCCCAGAATTTTGGTGGCTGGGGACACTATGGACAGTGTTAAACAGAGTGCCGCCCTCTGCTTGCTACGTCTCTACCGCACCTCTCCTGATCTCGTTCTCACAAATGAATGGACCTCGCGAGTTGTCCATCTTCTCAACGACCAGCACTTGGGTGTCGTAACTGCTGCAACCAGTCTTATCACTACACTGGCACAGAAAAACCCAGAAGAATTCAAAACATCGGTGTCACTGGCAGTCTCCAGGCTGAGCAGGATTGTCACATCGGCCTCCACAGACTTGCAGGATTACACCTACTACTTTGTTCCCGCTCCTTGGCTGTCTGTGAAACTGCTGAGGCTGTTACAGTGTTATCCTCCCCCAGAGGACCCTGCAGTTCGAGGCAGACTGACAGAGTGCTTGGAGACAATCCTGAACAAGGCACAAGAGCCCCCCAAATCCAAAAAGGTGCAGCATTCCAATGCCAAGAATGCCGTATTGTTTGAGGCAATAAGTCTCATAATCTACCATGACAGTGAGCCCAACCTCCTTGTCAGGGCATGCAACCAACTCGGACAGTTTCTTCAGCATCGAGAGACCAATCTGCGGTACCTGGCTCTGGAGAGCATGTGTACGCTAGCCAGCTCAGAATTTTCCCACGAGGCGGTGAAGACGCACATAGAAACTGTCATCAATGCACTAAAGACAGAAAGGGACGTAAGTGTGCGACAGAGGGCTGTTGATCTCTTGTATGCAATGTGTGACAGGAGTAACGCACAACAGATTGTGGCAGAGATGCTGAGCTACCTGGAGACAGCTGATTATTCCATTCGGGAGGAGATTGTGCTAAAAGTGGCCATCCTTGCTGAAAAATATGCCGTAGATTACACGTGGTACGTGGACACAATACTGAACCTCATTCGCATTGCTGGGGACTATGTTAGTGAGGAAGTTTGGTATCGTGTTATCCAGATTGTTATCAACAGAGACGATGTGCAGGGCTATGCAGCCAAGACTGTGTTTGAGGCACTCCAAGCTCCTGCTTGCCATGAGAATCTTGTCAAGGTTGGAGGGTACATTCTTGGTGAATTCGGAAACCTCATTGCTGGAGATCCACGCTCTAGTCCTTTAATTCAGTTTAACCTGCTGCACTCCAAGTTCCACCTGTGTAGCGTTCCTACCCGGGCGCTGCTCCTCTCTGCCTACATCAAGTTTATAAACCTCTTTCCGGAAATTAAGACTACCATACAGGATGTGCTACGCAGCGACAGCCAGCTCCGAAATGCCGATGTGGAGCTGCAGCAAAGAGCTGTGGAATATCTTCGTCTCAGCTCCATCGCCAGCAATGACATCCTGGCTACAGTTTTGGAAGAGATGCCCCCATTTCCTGAGCGAGAATCTTCCATCCTAGCAAAGCTAAAGAAGAAGAAGGGACCCAGCACAGTTACAGATCTGGAAGAGACAAAAAAAGAGAAGAGTAATTCTGATTTAAATGGGATCACTGAGCATGCCCCTCTCAGTACAACGTCCACTCCATCTCCCTCCGCTGACCTACTGGGTTTGGGAGCTGCCTCTGGTTCCAGTTCTACCCCAACGACGGCTCCCTCTGCTGGCAGTCTACTTGTTGACGTCTTTGCAGAGCCCTCCCTGCCTGTTGCTGCTGTCACTACAGAAGCAGATGACAATTTTCCAAGGTTTATCTGTAAGAACAATGGAGTTCTCTTTGAGAATCAGCTGCTACAAATTGGCATAAAATCAGAGTTTCGGCAAAATCTAGGGCGAATGTTTATCTTCTTTGGGAACAAGATGTCCTCACAGTTTCAGAACTTCACAACTACATTAATATGTTCAGATGAACTTTCTGCCAGTCTGAATCTGCAGTCGAAGCCCGCAGAGCCTACCATAGATGGAGGTGCCCAGGTACAGCAGGTGGTGAACGTTGAATGCGTGCAGGAATTTACAGATCTTCCTCTTCTAAACATCCAGTTCAGATACGGAGGAGCATTCCAGAATGTATCGGTGAAGCTGCCTATCACACTGAATAAGTTCTTTCAGCCAACAGAAATGAACTCTCAGGATTTTTTCCAGCGTTGGAAGCAGCTTAGCAGCCCTAATCAAGAGGTCCAGAAAATTTTCAAGGCAAAGAACCCAATGGATACAGATATCACAAAGGCCAGGCTCATTGGATTTGGCCCAGCTGTCATGGATAATGTGGATCCAAACCCGTCCAATTACGTAGCTGCTGGAATCATCCAGGCCAAAACCCGACAAGTTGGGTGCCTTTTAAGGCTTGAACCCAATGAGCAGGCCCAGATGTACCGGCTCACTATACGCACAAGCAAAGAAGAGGTTTCCCAGACGTTATGTGACCTGCTTTCTGAGCAGTTTTAA
Full Trace Sequence: cgggcggccacagtacaaccaggcagctcccccacggcccaggacagagtgggcagggtcatcgtttctccccctgcgtcttggctacctgcggtgtcgtgaaagatgcctgccgtgtctaaaggggatgggatgcggggcctggccgtgttcatatcagacatcagaaactgcaaaagtaaagaagcagaaataaagagaataaacaaagagctggccaatattcgttccaagttcaagggagacaaagctctagatggctatagcaagaagaaatatgtctgcaagctgctctttatctttctgctgggccatgacattgactttggacacatggaggcagtaaatctgctgagctccaacaagtacacagagaagcagattggctacctttttatctctgtgctggtgaactctaacagcgagcttattaggctcatcaacaatgccatcaagaacgacctgtcaagccgcaaccccacctttatgggccttgccctgcactgcattgctaatgtgggtagccgagaaatggctgaggcatttgctggtgagatccccagaattttggtggctggggacactatggacagtgttaaacagagtgccgccctctgcttgctacgtctctaccgcacctctcctgatctcgttctcacaaatgaatggacctcgcgagttgtccatcttctcaacgaccagcacttgggtgtcgtaactgctgcaaccagtcttatcactacactggcacagaaaaacccagaagaattcaaaacatcggtgtcactggcagtctccaggctgagcaggattgtcacatcggcctccacagacttgcaggattacacctactactttgttcccgctccttggctgtctgtgaaactgctgaggctgttacagtgttatcctcccccagaggaccctgcagttcgaggcagactgacagagtgcttggagacaatcctgaacaaggcacaagagccccccaaatccaaaaaggtgcagcattccaatgccaagaatgccgtattgtttgaggcaataagtctcataatctaccatgacagtgagcccaacctccttgtcagggcatgcaaccaactcggacagtttcttcagcatcgagagaccaatctgcggtacctggctctggagagcatgtgtacgctagccagctcagaattttcccacgaggcggtgaagacgcacatagaaactgtcatcaatgcactaaagacagaaagggacgtaagtgtgcgacagagggctgttgatctcttgtatgcaatgtgtgacaggagtaacgcacaacagattgtggcagagatgctgagctacctggagacagctgattattccattcgggaggagattgtgctaaaagtggccatccttgctgaaaaatatgccgtagattacacgtggtacgtggacacaatactgaacctcattcgcattgctggggactatgttagtgaggaagtttggtatcgtgttatccagattgttatcaacagagacgatgtgcagggctatgcagccaagactgtgtttgaggcactccaagctcctgcttgccatgagaatcttgtcaaggttggagggtacattcttggtgaattcggaaacctcattgctggagatccacgctctagtcctttaattcagtttaacctgctgcactccaagttccacctgtgtagcgttcctacccgggcgctgctcctctctgcctacatcaagtttataaacctctttccggaaattaagactaccatacaggatgtgctacgcagcgacagccagctccgaaatgccgatgtggagctgcagcaaagagctgtggaatatcttcgtctcagctccatcgccagcaatgacatcctggctacagttttggaagagatgcccccatttcctgagcgagaatcttccatcctagcaaagctaaagaagaagaagggacccagcacagttacagatctggaagagacaaaaaaagagaagagtaattctgatttaaatgggatcactgagcatgcccctctcagtacaacgtccactccatctccctccgctgacctactgggtttgggagctgcctctggttccagttctaccccaacgacggctccctctgctggcagtctacttgttgacgtctttgcagagccctccctgcctgttgctgctgtcactacagaagcagatgacaattttccaaggtttatctgtaagaacaatggagttctctttgagaatcagctgctacaaattggcataaaatcagagtttcggcaaaatctagggcgaatgtttatcttctttgggaacaagatgtcctcacagtttcagaacttcacaactacattaatatgttcagatgaactttctgccagtctgaatctgcagtcgaagcccgcagagcctaccatagatggaggtgcccaggtacagcaggtggtgaacgttgaatgcgtgcaggaatttacagatcttcctcttctaaacatccagttcagatacggaggagcattccagaatgtatcggtgaagctgcctatcacactgaataagttctttcagccaacagaaatgaactctcaggattttttccagcgttggaagcagcttagcagccctaatcaagaggtccagaaaattttcaaggcaaagaacccaatggatacagatatcacaaaggccaggctcattggatttggcccagctgtcatggataatgtggatccaaacccgtccaattacgtagctgctggaatcatccaggccaaaacccgacaagttgggtgccttttaaggcttgaacccaatgagcaggcccagatgtaccggctcactatacgcacaagcaaagaagaggtttcccagacgttatgtgacctgctttctgagcagttttaatccgccatcctgctggccccgaaactccttgtctttgtgatctcccactcctgccttccagtcgttcatctcagtgacaataaatattacatacacaaaaaaaaaaaaaaaaa
Translation: MPAVSKGDGMRGLAVFISDIRNCKSKEAEIKRINKELANIRSKFKGDKALDGYSKKKYVCKLLFIFLLGHDIDFGHMEAVNLLSSNKYTEKQIGYLFISVLVNSNSELIRLINNAIKNDLSSRNPTFMGLALHCIANVGSREMAEAFAGEIPRILVAGDTMDSVKQSAALCLLRLYRTSPDLVLTNEWTSRVVHLLNDQHLGVVTAATSLITTLAQKNPEEFKTSVSLAVSRLSRIVTSASTDLQDYTYYFVPAPWLSVKLLRLLQCYPPPEDPAVRGRLTECLETILNKAQEPPKSKKVQHSNAKNAVLFEAISLIIYHDSEPNLLVRACNQLGQFLQHRETNLRYLALESMCTLASSEFSHEAVKTHIETVINALKTERDVSVRQRAVDLLYAMCDRSNAQQIVAEMLSYLETADYSIREEIVLKVAILAEKYAVDYTWYVDTILNLIRIAGDYVSEEVWYRVIQIVINRDDVQGYAAKTVFEALQAPACHENLVKVGGYILGEFGNLIAGDPRSSPLIQFNLLHSKFHLCSVPTRALLLSAYIKFINLFPEIKTTIQDVLRSDSQLRNADVELQQRAVEYLRLSSIASNDILATVLEEMPPFPERESSILAKLKKKKGPSTVTDLEETKKEKSNSDLNGITEHAPLSTTSTPSPSADLLGLGAASGSSSTPTTAPSAGSLLVDVFAEPSLPVAAVTTEADDNFPRFICKNNGVLFENQLLQIGIKSEFRQNLGRMFIFFGNKMSSQFQNFTTTLICSDELSASLNLQSKPAEPTIDGGAQVQQVVNVECVQEFTDLPLLNIQFRYGGAFQNVSVKLPITLNKFFQPTEMNSQDFFQRWKQLSSPNQEVQKIFKAKNPMDTDITKARLIGFGPAVMDNVDPNPSNYVAAGIIQAKTRQVGCLLRLEPNEQAQMYRLTIRTSKEEVSQTLCDLLSEQF
Donor tissue: tailbud