ORFeome > apoa1 – XORFeome 2.0

apoa1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis apolipoprotein A-I, mRNA (cDNA clone MGC:89745 IMAGE:7027215), complete cds
Gene Symbol: apoa1
Gene ID: 448709
ORF gb_acc: MG133058
ORF ID: 10464

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC077663

Library Location

Plate ID: GDExt11005
Well Location: A10

EST Sequences

Clone: MGC:89745 IMAGE:7027215
Trimmed Sequence: ATGAAGAACCTAGTCCTACTAGCAGTACTGTTCCTCTCAGGAACACAGGCAAAGTATTTCCCTTGGCAGCATGAAGAGCCCCACACTCCAGCCCAGCAGGTGCGGGAAGTCTTAGAGAGCTACGTACACAAAGTTCGGGACTTGGGCAGAGAAGCTGTGAGCCAACTGGAGACCTCTGATCTCGGAAAACAACTTGACCTGAAGATCACTGAGAAGCTTGACACCTTTGGTACCAATGCTATGAACCTGAGAAAGCAAATAAATCCCTATGTAGAAAATATCAGGGAACAGGTGTCCAAAGAGCTAGAAAAGGAACTCCCAGTAATCAAGGAGAAAATCCGCCCCATCCTGGAAGCTTTCCAGAAACGTTGGGCTGATGATGCAAAGGCTTACCAGGAGAAAATCTCTCCCCTGGTAGCTGAGCTTCAAAAGCAAACCAAGAACAACCTGGATTCCTTGTATAAAAAGATCACTCCTATTGCTGAAGAGATAAGGGACAAAGTGAGAGTGGATGTTGACTCCCTTCGCTCAAGGCTCACACCCTACAGTGAAGAGGTCAGGGTAAAGCTGGTCGAGAAACTAGAAGAGCTTAAGGCCAATGCAGGTCCCAGAGCTGAGGAGTACAGAGCCCAACTGTCACAGCATATTGAGAATTTGAAGGAGAAGTATGGACCCCTGGCCCAGAGCATCAGAGAACGCCTGGTACCCCATGCAGAGGAGGCCAGAAACAACCTGGCAAAAATTTGGGAAAATCTGAGAGCCAAGCTCCAAAGACAGGGTGCCTAA
Full Trace Sequence: acaggagcaactaaccagcaaagcaggttggagagtttgcaactatgaagaacctagtcctactagcagtactgttcctctcaggaacacaggcaaagtatttcccttggcagcatgaagagccccacactccagcccagcaggtgcgggaagtcttagagagctacgtacacaaagttcgggacttgggcagagaagctgtgagccaactggagacctctgatctcggaaaacaacttgacctgaagatcactgagaagcttgacacctttggtaccaatgctatgaacctgagaaagcaaataaatccctatgtagaaaatatcagggaacaggtgtccaaagagctagaaaaggaactcccagtaatcaaggagaaaatccgccccatcctggaagctttccagaaacgttgggctgatgatgcaaaggcttaccaggagaaaatctctcccctggtagctgagcttcaaaagcaaaccaagaacaacctggattccttgtataaaaagatcactcctattgctgaagagataagggacaaagtgagagtggatgttgactcccttcgctcaaggctcacaccctacagtgaagaggtcagggtaaagctggtcgagaaactagaagagcttaaggccaatgcaggtcccagagctgaggagtacagagcccaactgtcacagcatattgagaatttgaaggagaagtatggacccctggcccagagcatcagagaacgcctggtaccccatgcagaggaggccagaaacaacctggcaaaaatttgggaaaatctgagagccaagctccaaagacagggtgcctaaaaccttcaccttctatctgtgaagatgtatgttggtgcttcaaacctcatccaaacttctcgctcacacaaccacctattatctcaacttatactattaccatgatgctggcctgagagaggacatgtttacatgctgctagcccttacattatctccaagagggcaaccaatattgatatgaaatgaattgctacatatcttttattgtttacatatttcatataaattgccctgagggcacatggtcctctctcatgtttcaatgtgaaaataaagacattagtatataaaaaaaaaaaaaaaa
Translation: MKNLVLLAVLFLSGTQAKYFPWQHEEPHTPAQQVREVLESYVHKVRDLGREAVSQLETSDLGKQLDLKITEKLDTFGTNAMNLRKQINPYVENIREQVSKELEKELPVIKEKIRPILEAFQKRWADDAKAYQEKISPLVAELQKQTKNNLDSLYKKITPIAEEIRDKVRVDVDSLRSRLTPYSEEVRVKLVEKLEELKANAGPRAEEYRAQLSQHIENLKEKYGPLAQSIRERLVPHAEEARNNLAKIWENLRAKLQRQGA
Donor tissue: