ORFeome > arf6 – XORFeome 2.0

arf6 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ADP-ribosylation factor 6, mRNA (cDNA clone MGC:76053 IMAGE:5307293), complete cds
Gene Symbol: arf6
Gene ID: 395051
ORF gb_acc: MG132754
ORF ID: 10057

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064861

Library Location

Plate ID: GDExt11001
Well Location: G01

EST Sequences

Clone: MGC:76053 IMAGE:5307293
Trimmed Sequence: ATGGGTAAAATGCTATCCAAGGTGTTTGGGAATAAGGAGATGCGGATATTGATGTTGGGTTTGGATGCTGCTGGGAAGACCACCATTCTTTACAAACTCAAGCTAGGACAGTCAGTCACCACTATCCCAACTGTAGGTTTCAATGTAGAGACTGTTACCTACAAAAACGTAAAATTTAATGTCTGGGATGTAGGTGGCCAGGACAAAATTCGGCCTCTCTGGCGGCATTACTATACTGGAACACAGGGTCTCATCTTTGTTGTTGATTGTGCAGATCGAGATCGAATTGATGAGGCCCGTCAAGAACTCCACAGAATTATTAATGACCGAGAGATGCGAGATGCCATTATTCTCATCTTTGCCAATAAACAGGACCTTGCAGATGCCATGAAGCCTCATGAGATCCAGGAAAAGCTTGGACTTACCCGGATTAGGGATAGAAACTGGTATGTCCAGCCATCTTGTGCAAATACCGGAGAGGGACTTTATGAAGGTCTCATGTGGTTGACATCAAATTACAAATCTTAA
Full Trace Sequence: ctcagagcttccatcatgggtaaaatgctatccaaggtgtttgggaataaggagatgcggatattgatgttgggtttggatgctgctgggaagaccaccattctttacaaactcaagctaggacagtcagtcaccactatcccaactgtaggtttcaatgtagagactgttacctacaaaaacgtaaaatttaatgtctgggatgtaggtggccaggacaaaattcggcctctctggcggcattactatactggaacacagggtctcatctttgttgttgattgtgcagatcgagatcgaattgatgaggcccgtcaagaactccacagaattattaatgaccgagagatgcgagatgccattattctcatctttgccaataaacaggaccttgcagatgccatgaagcctcatgagatccaggaaaagcttggacttacccggattagggatagaaactggtatgtccagccatcttgtgcaaataccggagagggactttatgaaggtctcatgtggttgacatcaaattacaaatcttaaactctgtttctattactgttaatttttttgtactttcgctttgatttggtttattttgaaaaccactgaaggactggcagcatagctgtgtatttttttctttttttttttttgacatatattattcctaaatgctctgcagaagagcctggaaggagttattggcttcgccccacttgggagcaaggaagggtagaaggtatagaacacgaagcttgatgttctttgcacctagtgagatgggaaaataaccctttgcagtgtcagccttaaccatcagtgagctagtatgaaatattaaaggacttaaaagtttaaaagacaaagaaaccctgaaaataaatgatgttcacgtgaaagatcaaatgcaaattaaagtttgtagttaaactgttactgtgtacacatgttccccagcatagcagtatttaatcatccgcttttaaagggctgggctgggctatgtagttaaccttaaagtccacgttcctgagcaagaccaagacctggtacatgtgcacaagtactctgacattgtacatgcttcatgtctccttggaggcttgcgttctaacttttgattgtactgcttgcaatgcagtgtcagtgggcgagggaaggatgcacgtgcgcagaataaacttaagtgacgtatacaatgactcctaatgaaaaaatagcagccgcaaagtgcccagtggggaataactttggaggcaaaagaaagcagttttgaaaatccaaaataattgcggtttatgtggcaagtgattgggcaaagtagcaaagggaagggtttccttgtcctttaacactgccgtgcattgcacattcttctgacctcaatgtatgagacagttttttacattccctgtgcccataaaattcccaatgttttttttgtgtcatttaataagggacggagtaataagaaccttttacctttagtgttgcagtataaaaagtccaaacagttgattccgtcctgtggaaaatatgagagaaatgtacattcagtgttaccattgctgagtgttttaaggcattgtgaaatatttataatacgtttatttatgtgccagttccatcaccacctgtgggtcaacagggtgctttgaaccggaagttcaaagcctacagaaaactaagttatttgacagatataaatcctgaaaggaaacttctgacttgtctaacgcctcatatattctcctgtacagtaggggaacatggtatatcctatgttatgctgtgactggggtgtttcagaagaaccgcttctaaaatggagttaaaccgaatgtgtgcattgctggagaatatgctctggccagttttgataagtgtctatttttccttcatccttattggtgctatttaatcttattttttgtgatgagaaattacaagttttttaaagatttgtgccacacactggtttcttttacaaaattaacaatctgcacatcatactgatcaggcactttagtaaggcttagttcactatgttgctgcactgatttatgtaaagactgacatactaatacaatgcctaatcaagttaatgtacacacaaaggttggtttactggtaattaatcttaaatacattccctggatttttgttcttgttagacttttttccatggttgtcattccatctttcatctgaaggatcaaggaaggagcaaagtataatcttcaaagtgcgccaagcagtctgtaatactaaaatcatgctataattttaccttaaggacttgccaatttttcatagactgcgtattaaactttgcacctataatttaatgtttcttttgttatgtttttagcctttggaaatcatgcatttttcaaattaaactgctccttatttgaataaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGKMLSKVFGNKEMRILMLGLDAAGKTTILYKLKLGQSVTTIPTVGFNVETVTYKNVKFNVWDVGGQDKIRPLWRHYYTGTQGLIFVVDCADRDRIDEARQELHRIINDREMRDAIILIFANKQDLADAMKPHEIQEKLGLTRIRDRNWYVQPSCANTGEGLYEGLMWLTSNYKS
Donor tissue: gastrula