ORFeome > arhgap1 – XORFeome 2.0

arhgap1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis Rho GTPase activating protein 1, mRNA (cDNA clone MGC:89633 IMAGE:6995679), complete cds
Gene Symbol: arhgap1
Gene ID: 493503
ORF gb_acc: MG134375
ORF ID: 12063

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC081352

Library Location

Plate ID: GDExt11019
Well Location: E11

EST Sequences

Clone: MGC:89633 IMAGE:6995679
Trimmed Sequence: ATGGCGTCCGACCCTCTGTCAGACCTTAACGATGACTTGGATAAGGATGAAACCAACCAGCTGGACCAACTGAAACTGGCGTCTTTGGATGATAAGAACTGGCCCTCGGATGACGTGCAGGATTATCCGAATAACGCGAATGATTCGAAGCCTTCCCCTGACCCTGTGACCCACCTACGCTGGGACGACCCATACTATGACATTGCGTGGCGTCAGATTGTAGAGGTAGCAGGTGATGACAAGTACGGGCGTAAAATTGTGGTGTTCAGCGCCTGCCGTCTGCCGCCCTGCCACGAGATTGACCACGTCAAGCTGTTACAGTACCTGAAGCATACGCTGGACCAGTACGTGGAAAGCGACTACACATTGGTTTACCTGCACCATGGCCTTACCAGTGAGAACAAGCCTTCCTTGGGGTGGCTTAGAGATGCCTACCGGGAGTTTGACCGCAAATACAAGAAAAACATCAAGGCCCTTTACATTGTTCATCCAACGATGTTCATCAAGACTCTGCTGATTCTTTTTAAGCCCATCATCAGCTTCAAGTTTGGCCGGAAGATTTTTTATGCCAATTACCTGAGTGACCTGGAGGAGCACATGAAGGTGGAGCAGCTGGGAATCCCCAAACAAGTACTCAAGTATGATGATCTTATCCGCTCTAATCTGAAGACCTCAGCAGCAACTCAGAAACCCGGCCCACCCCGACCTCCACTTCCAAACCAGCAGTTTGGCATCTCCTTACTGCACCTGAAAGAGAAGCACCCTGAGAATGACAAGATACCCCTAGTTGTACGGGACACGGTGGCCTTCCTGCAGGAAAACGCTCTGAGCACTGAGGGAATATTCCGGAGGTCGGCCAGAACCCAGATAGTCCGGGAGGTCCAGCAGAAGTACAACATGGGGGTCCAGGTCACGTTCCAGCAATACGATGATGTTCACCTGCCGGCCGTCATCCTGAAAACATTCCTGCGGGAGCTTCCCGAGCCGCTGCTGACGTATAACCTCTACAGCTTTGTCGTTGACTTCTCCAAGCAGGAGCAGAAGATTGAATCTACTCTCCAAATCCTGCAGACTCTGCCCAAGGAGAACTATGACGTCCTTCAGTTTCTTACAGCCTTCCTTGTAGAGGTATCTTCCCACAACGAACAGAACAAGATGACGACCACTAACCTGGCCGTGGTGTTCGGCCCGAACCTTTTGTGGGTAAAAGATGCCGCCATGACTTTAAAAGCCATTAACCCTATCAACACCTTCACCAAGTTTCTGCTGGACAACCAGAGAGAGCTGTTTGGGGACCCCGAGCCTTGA
Full Trace Sequence: agcagatcgggtgtgtagggtttcagcgctggtgaagagccgaggccacagagatcagtatggcgtccgaccctctgtcagaccttaacgatgacttggataaggatgaaaccaaccagctggaccaactgaaactggcgtctttggatgataagaactggccctcggatgacgtgcaggattatccgaataacgcgaatgattcgaagccttcccctgaccctgtgacccacctacgctgggacgacccatactatgacattgcgtggcgtcagattgtagaggtagcaggtgatgacaagtacgggcgtaaaattgtggtgttcagcgcctgccgtctgccgccctgccacgagattgaccacgtcaagctgttacagtacctgaagcatacgctggaccagtacgtggaaagcgactacacattggtttacctgcaccatggccttaccagtgagaacaagccttccttggggtggcttagagatgcctaccgggagtttgaccgcaaatacaagaaaaacatcaaggccctttacattgttcatccaacgatgttcatcaagactctgctgattctttttaagcccatcatcagcttcaagtttggccggaagattttttatgccaattacctgagtgacctggaggagcacatgaaggtggagcagctgggaatccccaaacaagtactcaagtatgatgatcttatccgctctaatctgaagacctcagcagcaactcagaaacccggcccaccccgacctccacttccaaaccagcagtttggcatctccttactgcacctgaaagagaagcaccctgagaatgacaagatacccctagttgtacgggacacggtggccttcctgcaggaaaacgctctgagcactgagggaatattccggaggtcggccagaacccagatagtccgggaggtccagcagaagtacaacatgggggtccaggtcacgttccagcaatacgatgatgttcacctgccggccgtcatcctgaaaacattcctgcgggagcttcccgagccgctgctgacgtataacctctacagctttgtcgttgacttctccaagcaggagcagaagattgaatctactctccaaatcctgcagactctgcccaaggagaactatgacgtccttcagtttcttacagccttccttgtagaggtatcttcccacaacgaacagaacaagatgacgaccactaacctggccgtggtgttcggcccgaaccttttgtgggtaaaagatgccgccatgactttaaaagccattaaccctatcaacaccttcaccaagtttctgctggacaaccagagagagctgtttggggaccccgagccttgagcttattccactcccgcagcaacactcgccacactgccagtcaccacacagccgcctctcccatggtgcagtgcgttacttgccccccccgtaagcgtgcgtctgtgctttcctgccacacgttggagcgggcatctccaatacaagtgatagcacaaagactctttcaatgcggacaccctgcgcggttagctttctagtgctgctccgagacagccggtgcctctggctggcgagaggcacttttgttacctgtgccatggttgtgtaagggcaagtggttgggctagaggtgacctactgtggggtgtgacctttattatatatctatatatttgggcaggaggggcttttaattctgatttagcctcttattttctgattccttctaccccccccctcctctctatggtgtgcacctctcattgctttggtacagaaggaggataactaacagtgagtcacaagcaatctgattggctgtgtataaaggtttattatccctttatgattagtatttgggctgttcatgatttgggtaaatagatacccaagctcctaagctgctgaacagataaaggtggtaaatcaggttactgtaatgatcaggtgtaagcagcagggggcagcactagtgttcagcctacctacctacctaggttgtaggttctgattggctggttgcctccaacagtgtagcaacaaccaatagatgaagataattatgtcccgtcactcatctcttttctttttttttttttaaacacgttggattttaatgaatgtaaataagagcagagggcagaatgggggtgtaaataagctgggcactgggtatctgacctctgtaaccccctgagctgtgccacctttttattcctgtcgttttgagtgccagtgccattcctgcaccattccccctgtgggaccttatacttactatcaatatgcagcgtgtatgtccctgtatacattccatgctctgtaaggaattgtgcccccttgtgtctgagttctgtactaacactccttgttgctttccaaaaaaaacgaagaaacaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MASDPLSDLNDDLDKDETNQLDQLKLASLDDKNWPSDDVQDYPNNANDSKPSPDPVTHLRWDDPYYDIAWRQIVEVAGDDKYGRKIVVFSACRLPPCHEIDHVKLLQYLKHTLDQYVESDYTLVYLHHGLTSENKPSLGWLRDAYREFDRKYKKNIKALYIVHPTMFIKTLLILFKPIISFKFGRKIFYANYLSDLEEHMKVEQLGIPKQVLKYDDLIRSNLKTSAATQKPGPPRPPLPNQQFGISLLHLKEKHPENDKIPLVVRDTVAFLQENALSTEGIFRRSARTQIVREVQQKYNMGVQVTFQQYDDVHLPAVILKTFLRELPEPLLTYNLYSFVVDFSKQEQKIESTLQILQTLPKENYDVLQFLTAFLVEVSSHNEQNKMTTTNLAVVFGPNLLWVKDAAMTLKAINPINTFTKFLLDNQRELFGDPEP
Donor tissue: neurula