ORFeome > arl8a – XORFeome 2.0

arl8a – XORFeome 2.0

General Information

Species: Xenopus tropicalis ADP-ribosylation factor-like 8A, mRNA (cDNA clone MGC:75773 IMAGE:5381865), complete cds
Gene Symbol: arl8a
Gene ID: 394587
ORF gb_acc: MG132936
ORF ID: 10305

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061301

Library Location

Plate ID: GDExt11004
Well Location: G01

EST Sequences

Clone: MGC:75773 IMAGE:5381865
Full Trace Sequence: ccgtagtgttagcgagtcgcagctgcaaagagcgacagtagcctcatattgggggctgcgcgcaaggctctggtttgggtggttggtcccctgtcgcactggagatgttggccttattcaacaagctcttggactggttcaaggcgctgttttggaaggaggagatggagctcaccttggtggggctgcagtattcggggaagaccacctttgtcaacgtgattgcgtctggacagttcaatgaggacatgattccgactgttggatttaacatgcggaaaatcaccaagggtaatgtaaccataaagctctgggatatagggggccagccacgctttcgaagtatgtgggaaagatactgtcgaggagtaagtgctattgtttacatggtggatgcagcagatcaggataagattgaggcatcaaaaaatgaactgcataatttactggacaaggctcagctgcaaggaatcccggttcttgtgctaggaaacaagagagacattccaggggctttagatgagaaagaattaatagagagaatgaacctttctgctattcaagacagggagatctgctgctactcaatttcctgcaaagagaaggacaatattgatattactctacagtggcttatccagcactccaaatcccggagaagctgagaagacctaactcctatctgccatctttaagtatcctggactttgttttttgtctgggactacaccatagaactgagaagatggaacggcacccaagtccctgaaactctctcttacccatcatatctctgtgtattctctttctcatctgccttctctctccctgtctctttttaatggtatttttacactctcacttacctttgtaacataaggtccctaatgccttttaggctttccctatttcttcttgcatccttttacctttttatcgttgttgatgtgtgtgtacgtgtatatatctatacatgtgtatataaatatatatataatttgtttttatttaaagttcagtcatttagttcttcgctggatttagtatcacctcacaactgcaatatttgtaaaaggcgtgagtgcattgactaaaataaccagcaaaactttacttactatacttgtttataacacttcatccttaaa
Donor tissue: tadpole