ORFeome > arpc1b – XORFeome 2.0

arpc1b – XORFeome 2.0

General Information

Species: Xenopus tropicalis actin related protein 2/3 complex, subunit 1B, 41kDa, mRNA (cDNA clone MGC:88952 IMAGE:7003064), complete cds
Gene Symbol: arpc1b
Gene ID: 448555
ORF gb_acc: MG134016
ORF ID: 11630

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076887

Library Location

Plate ID: GDExt11016
Well Location: E03

EST Sequences

Clone: MGC:88952 IMAGE:7003064
Trimmed Sequence: ATGGCCTACCACAGTTTTCTACTGGAGCCCATTACCTGTCATGCTTGGAACAAAGATGCAACCCAAATTGCCTTCTGTCCAAATAGTCATGATGTTCACATTTACAAGAAAGATGGAGATAAATGGACCAAAATCCATGAGCTGAAGGAACATAATGGACAAGTCACAGGTATTGACTGGGCTCCTGACAGCAATCGCATTGTAACCTGTGGTACGGATCGTAATGCCTATGTGTGGACTCTAAGAAACAATGTGTGGAAACCGACACTGGTCATTCTCAGGATTAACCGTGCTGCACGTTGTGTAAAGTGGTCACCTAAGGAGAACAAGTTTGCAGTGGGCAGTGGATCCAGGCTAATTTCCATCTGCTACTTCGAGCAGGAAAATGATTGGTGGGTGTGTAAGCACATCAAGAAACCAATACGCTCAACGGTCCTGAGTCTGGATTGGCATCCAAACAATGTTCTTCTGGCAGCTGGGTCCAGTGATTTTAAGAGCAGGATCTTTTCAGCTTATATCAAAGAAGTCGAAGAACGCCCTGCCCCTACTCCATGGGGCTCCAAAATGCCTTTTGGAGAGTTGATGTTTGAGTCTAGCAGCAGCTGTGGGTGGGTGCATAGTGTCTGCTTTTCCCATAGTGGAGACCGCATGGCTTGGGTGAGCCATGATAGCACGATTTGCATTGCTGATGCCCCCAAGAAGATGAGAGTCACCACCTCGATTACAGACACTTTGCCGCTCTTGTGTTTGACCTTTATCACTGAGAACAGCCTGGTGGCTGCTGGCCATGACTGCTATCCAGTACTTTACTCTTATGTTGAAGCTCAGGGGACTTTGAGTTTTGGGGGAAAACTTGATATCCCCAAGCAGAGTTCCCAGAGAGGGATGACTGCACGAGAGAGATTTCAAAACCTGGACAAGAAGGCCAGCTCTGATACCAACAACGTTACCCTGGACTCCTTACACAAGAACAGCATCAGCCAAATATCTGTGCTGAGTGGTGGGAAGGCAAAGTGTTCCAAGTTCTGTACCACTGGCTTAGATGGAGGGATGTGCATCTGGGACGTCAAGATCCTGGAATCTGCAATGAAAGATCTGAAGATTAAGTGA
Full Trace Sequence: ggaagtagcaaaaagcctgggcagagtctgatacaagttccagacattcagcattccgctgcatctgtgttgactgctcagagtccacggacagcagccgtctttccctgtacctactaacaggagcaaaaatggcctaccacagttttctactggagcccattacctgtcatgcttggaacaaagatgcaacccaaattgccttctgtccaaatagtcatgatgttcacatttacaagaaagatggagataaatggaccaaaatccatgagctgaaggaacataatggacaagtcacaggtattgactgggctcctgacagcaatcgcattgtaacctgtggtacggatcgtaatgcctatgtgtggactctaagaaacaatgtgtggaaaccgacactggtcattctcaggattaaccgtgctgcacgttgtgtaaagtggtcacctaaggagaacaagtttgcagtgggcagtggatccaggctaatttccatctgctacttcgagcaggaaaatgattggtgggtgtgtaagcacatcaagaaaccaatacgctcaacggtcctgagtctggattggcatccaaacaatgttcttctggcagctgggtccagtgattttaagagcaggatcttttcagcttatatcaaagaagtcgaagaacgccctgcccctactccatggggctccaaaatgccttttggagagttgatgtttgagtctagcagcagctgtgggtgggtgcatagtgtctgcttttcccatagtggagaccgcatggcttgggtgagccatgatagcacgatttgcattgctgatgcccccaagaagatgagagtcaccacctcgattacagacactttgccgctcttgtgtttgacctttatcactgagaacagcctggtggctgctggccatgactgctatccagtactttactcttatgttgaagctcaggggactttgagttttgggggaaaacttgatatccccaagcagagttcccagagagggatgactgcacgagagagatttcaaaacctggacaagaaggccagctctgataccaacaacgttaccctggactccttacacaagaacagcatcagccaaatatctgtgctgagtggtgggaaggcaaagtgttccaagttctgtaccactggcttagatggagggatgtgcatctgggacgtcaagatcctggaatctgcaatgaaagatctgaagattaagtgatcaaacaggaagggtggattctctgttgccaagctgcttcatatttcatttataaaaggttgtcttgcagcagacaaaattttccaaagcttttaaaagccaaagcctatatccgcaattaattttgttttgcttaatgtatctgtgcttacttatggaacagaatatgctggacataatttttattctacactatcaaaataaattttaagtatttgttccaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAYHSFLLEPITCHAWNKDATQIAFCPNSHDVHIYKKDGDKWTKIHELKEHNGQVTGIDWAPDSNRIVTCGTDRNAYVWTLRNNVWKPTLVILRINRAARCVKWSPKENKFAVGSGSRLISICYFEQENDWWVCKHIKKPIRSTVLSLDWHPNNVLLAAGSSDFKSRIFSAYIKEVEERPAPTPWGSKMPFGELMFESSSSCGWVHSVCFSHSGDRMAWVSHDSTICIADAPKKMRVTTSITDTLPLLCLTFITENSLVAAGHDCYPVLYSYVEAQGTLSFGGKLDIPKQSSQRGMTARERFQNLDKKASSDTNNVTLDSLHKNSISQISVLSGGKAKCSKFCTTGLDGGMCIWDVKILESAMKDLKIK
Donor tissue: