ORFeome > atp1a1 – XORFeome 2.0

atp1a1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ATPase, Na+/K+ transporting, alpha 1 polypeptide, mRNA (cDNA clone MGC:76277 IMAGE:5379319), complete cds
Gene Symbol: atp1a1
Gene ID: 395044
ORF gb_acc:
ORF ID: 10109

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064884

Library Location

Plate ID: GDExt11002
Well Location: F02

EST Sequences

Clone: MGC:76277 IMAGE:5379319
Trimmed Sequence: ATGGGATACGGGGCCGGAAGAGACAAGTATGAGCCCGCAGCTACCTCTGAGCAGGGGGGCAAGAAGAAAAAGGGAAAGGGGAAGGATAAAGACATGGATGAGTTAAAGAAGGAATTGACCATGGAAGACCACAAACTGAGTCTGGATGAGCTGCACCGCAAGTTTGGGACGGACATGCAAAGGGGTCTGAGCACGGCCCGGGCAGCAGAGATCCTGGCACGAGATGGACCCAATGCCCTCACCCCGCCCCCCACTACTCCAGAGTGGGTGAAATTTTGCCGCCAGCTGTTCGGGGGGTTCTCTATGCTGCTGTGGATTGGAGCCATACTCTGCTTCCTGGCCTATGGTATCACTGCTGCCACGGAAGAGGAGCCAACGAATGATAATCTCTACCTCGGTGTTGTCTTGTCCGCTGTCGTTATCATCACCGGCTGCTTCTCTTACTACCAAGAGGCAAAGAGCTCTAAGATCATGGAGTCCTTCAAGAACATGGTTCCTCAGCAAGCCCTGGTAATCCGAAACGGAGAGAAGTTGAGTATTAATGCGGAAGACGTGGTTTTGGGTGACCTGGTAGAAGTGAAGGGAGGAGATCGGATACCTGCGGATGTTCGGATCATCTCCGCTCATGGCTGCAAGGTGGATAACTCTTCCCTCACTGGAGAGTCCGAACCCCAGACCCGCTCTCCTGACTTCACCAATGAGAACCCACTGGAGACCCGCAACATCGCCTTCTTCTCTACAAACTGTGTGGAAGGCACAGCCCGTGGCGTTGTCGTCAACACCGGTGATCGTACAGTGATGGGCCGTATCGCTACTCTGGCCTCTGGCCTGGAGGGAGGACGCACCCCCATTGCCATTGAAATTGAGCATTTTATTCACATCATCACCGGCGTGGCGGTCTTCCTGGGGGTCAGCTTCTTCATCCTGTCACTCATTCTGCAGTACACCTGGCTGGAGGCTGTCATCTTCCTCATTGGTATCATTGTTGCCAATGTGCCAGAGGGACTGCTGGCTACTGTCACGGTTTGCCTTACACTGACCGCCAAAAGAATGGCCCGCAAGAACTGTCTTGTGAAGAATCTGGAGGCTGTGGAGACTTTGGGATCCACTTCCACCATTTGCTCCGACAAAACGGGCACCCTGACACAGAACCGAATGACCGTAGCCCACATGTGGTTTGATAACCAGATCCATGAAGCCGACACCACGGAGAATCAGAGCGGTGCCTCCTTCGATAAGAGCTCCCCCACATGGACAGCCCTGTCCCGGGTTGCTGGATTGTGCAACAGAGCCGTGTTTCAGGCTGGACAAGAGAACACCCCCATCCTAAAGAGAGATGTTGCTGGAGATGCATCCGAATCCGCCCTGCTAAAGTGCATAGAACTCTGCTGTGGGTCTGTGAGGGATATGAGGGAAAAGAACCCCAAAGTGGCAGAAATTCCATTTAACTCTACAAACAAATACCAGCTGTCCGTACACAAGAATGCAAACCCATCAGAGTCCCGTTACATTCTGGTCATGAAAGGGGCCCCCGAGCGCATCCTGGACCGATGCTCCACCATTGTGCTGCAGGGCAAGGAGCAGCCCTTGGACGAGGAACTGAAGGATGCTTTCCAGAATGCCTACCTGGAGCTGGGGGGCCTGGGAGAGAGAGTATTAGGTTTCTGCCACCTTGCTTTGTCCGATGACCAGTTCCCTGATGGATTTCAGTTTGACACAGAGGAAGTGAACTTCCCAACAGAGAATCTTTGCTTCGTTGGGCTGATTTCCATGATTGACCCGCCCCGTGCCGCTGTGCCTGATGCCGTCGGCAAATGCCGAAGTGCTGGAATCAAGGTTATCATGGTGACAGGTGACCACCCAATCACAGCCAAGGCCATTGCTAAGGGAGTGGGAATCATCTCTGAAGGCAATGAAACAGTGGAGGATATTGCTGCCCGCCTCAACATTCCAGTCAACCAGGTGAACCCCAGAGATGCCAAGGCCTGTGTGATCCACGGGTCGGACCTGAAGGACATGGCACAAGAACAGATCGATGACATCCTGAAGCATCACACAGAGATCGTCTTTGCCAGAACATCCCCTCAGCAGAAGCTCATCATTGTGGAGGGTTGTCAGCGACAGGGTGCCATTGTGGCAGTGACGGGGGATGGTGTCAACGACTCCCCTGCTCTGAAGAAGGCAGATATTGGTATCGCTATGGGCATCGCTGGTTCCGATGTGTCCAAGCAGGCAGCCGACATGATCCTGTTGGATGATAACTTTGCTTCTATCGTTACTGGAGTAGAGGAAGGTCGTCTGATCTTTGATAACCTGAAGAAATCCATCGCCTACACCCTGACCAGTAACATCCCAGAAATCACACCCTTCCTCATCTTCATCGTCGCCAACATTCCTCTGCCCTTGGGCACAGTCACCATCCTGTGTATCGATCTGGGCACAGACATGGTCCCCGCTATCTCCCTGGCCTATGAGCAAGCCGAGAGTGACATCATGAAGAGACAGCCCCGTAATCCCAAAACAGACAAGCTGGTGAATGAAAGGCTTATCAGTATGGCCTATGGGCAGATCGGTATGATCCAAGCCCTGGGGGGGTTCTTCACATACTTTGTGATCCTGGCTGAGAATGGCTTTCTGCCCTGGACACTGCTGGGTATCAGAGTGAACTGGGATGACCGCTGGAATAACGACGTGGAGGACAGTTACGGGCAGCAGTGGACCTACGAGCAGAGGAAGATTGTGGAGTTCACGTGCCATACGGCTTTCTTCGTCAGTATCGTGGTGGTGCAGTGGGCCGATTTGATCATCTGCAAGACCAGAAGGAATTCAGTGTTCCAGCAGGGCATGAAGAATAAAATCCTTATCTTTGGGCTGTTTGAAGAGACTGCACTGGCTGCCTTCCTGTCCTACTGCCCTGGCATGGATGTGGCATTGCGCATGTACCCACTCAAGCCGACCTGGTGGTTCTGTGCCTTCCCATACTCGCTGCTCATCTTCATATACGATGAAGTCCGTAAGCTGATTATCCGGCGCAGCCCAGGCGGCTGGGTGGAGAAAGAAACCTACTATTAG
Full Trace Sequence: ggcgagctctaccgagaaacgaagaacagaccgccaccatgggatacggggccggaagagacaagtatgagcccgcagctacctctgagcaggggggcaagaagaaaaagggaaaggggaaggataaagacatggatgagttaaagaaggaattgaccatggaagaccacaaactgagtctggatgagctgcaccgcaagtttgggacggacatgcaaaggggtctgagcacggcccgggcagcagagatcctggcacgagatggacccaatgccctcaccccgccccccactactccagagtgggtgaaattttgccgccagctgttcggggggttctctatgctgctgtggattggagccatactctgcttcctggcctatggtatcactgctgccacggaagaggagccaacgaatgataatctctacctcggtgttgtcttgtccgctgtcgttatcatcaccggctgcttctcttactaccaagaggcaaagagctctaagatcatggagtccttcaagaacatggttcctcagcaagccctggtaatccgaaacggagagaagttgagtattaatgcggaagacgtggttttgggtgacctggtagaagtgaagggaggagatcggatacctgcggatgttcggatcatctccgctcatggctgcaaggtggataactcttccctcactggagagtccgaaccccagacccgctctcctgacttcaccaatgagaacccactggagacccgcaacatcgccttcttctctacaaactgtgtggaaggcacagcccgtggcgttgtcgtcaacaccggtgatcgtacagtgatgggccgtatcgctactctggcctctggcctggagggaggacgcacccccattgccattgaaattgagcattttattcacatcatcaccggcgtggcggtcttcctgggggtcagcttcttcatcctgtcactcattctgcagtacacctggctggaggctgtcatcttcctcattggtatcattgttgccaatgtgccagagggactgctggctactgtcacggtttgccttacactgaccgccaaaagaatggcccgcaagaactgtcttgtgaagaatctggaggctgtggagactttgggatccacttccaccatttgctccgacaaaacgggcaccctgacacagaaccgaatgaccgtagcccacatgtggtttgataaccagatccatgaagccgacaccacggagaatcagagcggtgcctccttcgataagagctcccccacatggacagccctgtcccgggttgctggattgtgcaacagagccgtgtttcaggctggacaagagaacacccccatcctaaagagagatgttgctggagatgcatccgaatccgccctgctaaagtgcatagaactctgctgtgggtctgtgagggatatgagggaaaagaaccccaaagtggcagaaattccatttaactctacaaacaaataccagctgtccgtacacaagaatgcaaacccatcagagtcccgttacattctggtcatgaaaggggcccccgagcgcatcctggaccgatgctccaccattgtgctgcagggcaaggagcagcccttggacgaggaactgaaggatgctttccagaatgcctacctggagctggggggcctgggagagagagtattaggtttctgccaccttgctttgtccgatgaccagttccctgatggatttcagtttgacacagaggaagtgaacttcccaacagagaatctttgcttcgttgggctgatttccatgattgacccgccccgtgccgctgtgcctgatgccgtcggcaaatgccgaagtgctggaatcaaggttatcatggtgacaggtgaccacccaatcacagccaaggccattgctaagggagtgggaatcatctctgaaggcaatgaaacagtggaggatattgctgcccgcctcaacattccagtcaaccaggtgaaccccagagatgccaaggcctgtgtgatccacgggtcggacctgaaggacatggcacaagaacagatcgatgacatcctgaagcatcacacagagatcgtctttgccagaacatcccctcagcagaagctcatcattgtggagggttgtcagcgacagggtgccattgtggcagtgacgggggatggtgtcaacgactcccctgctctgaagaaggcagatattggtatcgctatgggcatcgctggttccgatgtgtccaagcaggcagccgacatgatcctgttggatgataactttgcttctatcgttactggagtagaggaaggtcgtctgatctttgataacctgaagaaatccatcgcctacaccctgaccagtaacatcccagaaatcacacccttcctcatcttcatcgtcgccaacattcctctgcccttgggcacagtcaccatcctgtgtatcgatctgggcacagacatggtccccgctatctccctggcctatgagcaagccgagagtgacatcatgaagagacagccccgtaatcccaaaacagacaagctggtgaatgaaaggcttatcagtatggcctatgggcagatcggtatgatccaagccctgggggggttcttcacatactttgtgatcctggctgagaatggctttctgccctggacactgctgggtatcagagtgaactgggatgaccgctggaataacgacgtggaggacagttacgggcagcagtggacctacgagcagaggaagattgtggagttcacgtgccatacggctttcttcgtcagtatcgtggtggtgcagtgggccgatttgatcatctgcaagaccagaaggaattcagtgttccagcagggcatgaagaataaaatccttatctttgggctgtttgaagagactgcactggctgccttcctgtcctactgccctggcatggatgtggcattgcgcatgtacccactcaagccgacctggtggttctgtgccttcccatactcgctgctcatcttcatatacgatgaagtccgtaagctgattatccggcgcagcccaggcggctgggtggagaaagaaacctactattagagccttcgggtcgtccgaacatttcacgtcacttcctgcccctcggtctgcctgcacccacccgtcgcctgcgtgcacccgtctgactcagcctgttcccatggaagagatgcattttggcaaggggcgcagtgtcgcctgtgtgcgtcctgtacagagttctcattgtgccttctccggtattgtttttcgtttgtttcttttttttgtttctttttgtaatgggagcacgttcagagatgttttatatatctgcatttttacaaataaaggcggtttgaagagttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGYGAGRDKYEPAATSEQGGKKKKGKGKDKDMDELKKELTMEDHKLSLDELHRKFGTDMQRGLSTARAAEILARDGPNALTPPPTTPEWVKFCRQLFGGFSMLLWIGAILCFLAYGITAATEEEPTNDNLYLGVVLSAVVIITGCFSYYQEAKSSKIMESFKNMVPQQALVIRNGEKLSINAEDVVLGDLVEVKGGDRIPADVRIISAHGCKVDNSSLTGESEPQTRSPDFTNENPLETRNIAFFSTNCVEGTARGVVVNTGDRTVMGRIATLASGLEGGRTPIAIEIEHFIHIITGVAVFLGVSFFILSLILQYTWLEAVIFLIGIIVANVPEGLLATVTVCLTLTAKRMARKNCLVKNLEAVETLGSTSTICSDKTGTLTQNRMTVAHMWFDNQIHEADTTENQSGASFDKSSPTWTALSRVAGLCNRAVFQAGQENTPILKRDVAGDASESALLKCIELCCGSVRDMREKNPKVAEIPFNSTNKYQLSVHKNANPSESRYILVMKGAPERILDRCSTIVLQGKEQPLDEELKDAFQNAYLELGGLGERVLGFCHLALSDDQFPDGFQFDTEEVNFPTENLCFVGLISMIDPPRAAVPDAVGKCRSAGIKVIMVTGDHPITAKAIAKGVGIISEGNETVEDIAARLNIPVNQVNPRDAKACVIHGSDLKDMAQEQIDDILKHHTEIVFARTSPQQKLIIVEGCQRQGAIVAVTGDGVNDSPALKKADIGIAMGIAGSDVSKQAADMILLDDNFASIVTGVEEGRLIFDNLKKSIAYTLTSNIPEITPFLIFIVANIPLPLGTVTILCIDLGTDMVPAISLAYEQAESDIMKRQPRNPKTDKLVNERLISMAYGQIGMIQALGGFFTYFVILAENGFLPWTLLGIRVNWDDRWNNDVEDSYGQQWTYEQRKIVEFTCHTAFFVSIVVVQWADLIICKTRRNSVFQQGMKNKILIFGLFEETALAAFLSYCPGMDVALRMYPLKPTWWFCAFPYSLLIFIYDEVRKLIIRRSPGGWVEKETYY
Donor tissue: tailbud