ORFeome > atp4a – XORFeome 2.0

atp4a – XORFeome 2.0

General Information

Species: Xenopus tropicalis ATPase, H+/K+ exchanging, alpha polypeptide, mRNA (cDNA clone MGC:69393 IMAGE:5335335), complete cds
Gene Symbol: atp4a
Gene ID: 594945
ORF gb_acc:
ORF ID: 11903

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC090586

Library Location

Plate ID: GDExt11019
Well Location: G06

EST Sequences

Clone: MGC:69393 IMAGE:5335335
Trimmed Sequence: ATGTCTTCAGAGAAACCACCTGAGCCTTACATAGTGCCCATGGACGATCAAAAGGCTAACACAGAGAAGAAAAAAAATAAGCTGTTTGGGAAAAAAAAGGGGAATAAGTCTGGCAAAAAAGTGGACACCTTGAAAAAGGAACTAGAAATTAATGACCACAATTTAAGTATTGAAGAACTGGAAAAGAAATATAATGTGGATATAAAAGTGGGTCAGCCCCAGCAAACTGCAGATGAACTCTTTGCTCGAGATGGTCCTAACAGGCTAAGTCCTCCAAAGGGAACCCCTGAAATCGTCAAGTTTATGCTGTTGATGGCTGGTGGCTTTTCTATTGTCTTCTGGATTGGTTCGATATTGTGCTTCATTGCATATGGACTCCAGGTTGCACAGGACCCCACTGTCTCCAAAGACAATCTCTGGTTGGCCCTCATTCTAATTGCTGTGGTGGTTATGACAGCGTTATTTGCCTATTATCAGGAAGCCAAAAGCACAAACATCATGGCTGGCTTTAAGAACATGGTTCCCCAGCAAGCTTTGGTTCTTCGGGATGGCAAGCGAGTAGAATTGGTTGCAGAGAAACTCGTAGTTGGAGACATCGTTTTCATTAAAGGAGGAGACAAAATCCCTGCTGACTTAAGGATGTTGGAGAGTGCGGGGTGCAAGGTTGATAACTCATCACTGACTGGGGAGTCGGAGCCCCAGGCCCGAGGTACCGAGTGCACTGATGAAAATCCTTTGGAAACGAAGAATTTAGCCTTTTTCTCTACAACCTGCTTGGAGGGAACAGCATCTGGCATTGTAATTAACACTGGGGACCGCACAGTGATTGGCCGTATTGCTAATCTGGCTTCCCAAGTTGGAAATCAGAAAACACCTATTGCTCTGGAGATTGAACACTTCGTACACATGATCAGTGGCCTCGCTGTGGGAGTCGGAATCCTCTTCTTCATCATCTCCATTTCCATGGGTTACAGCGCTCTCAATGCCATAATATTCTGCATTGGTATTGTGGTGGCATATGTACCTGAAGGATTACTGGCCACAGTCACTGTCTGTCTTTCACTCACTGCAAAACGAATGGCCAAGAAAAACTGCCTGGTCAAGAATCTTGAGGCTGTGGAGACTCTTGGGTCCACCTCTGTCATTTGCTCTGACAAGACTGGCACCTTGACACAAAACCGTATGACCGTGGCACACATGTGGTTTGACAACATCATCCACAATGCTGACACTACAGAGGATCAGAGTGGGGAGGCATTTGATCAGAGCTCCCCTAGCTGGAAGGCACTTTTAAGAATTGCCACTCTTTGCAATCGTGCAGAATTCCTTGCCTGTGCAGAGGATGTGCCCATCAATAAGAGACAAGTAAATGGAGACGCATCAGAAGCCGCTTTATTAAAGTTCTCAGAACAACTTCAAGGTAACGTGTCAGATGTCAGAGCAAGAAACAAGAAAGTGTCAGAAATTCCATTTAATTCAAGTAACAAATACCAGGTCTCCATTCACATACCAGAAAACCCAGCAGAAAAAGGCTACCTGTTGGTAATGAAAGGGGCACCTGAACGGATCCTGGATCGATGTGAAACTATCATGATAGCAGGACAGGAATGGCCTCTTGATGAAGAAATGAAAGAAAATTTCCAGAATGCATACATGACACTTGGAGGCCTTGGGGAAAGAGTTTTAGGGTTCTGTCAACTCTCACTGCCCCATGATGTCTATGGACCAGGTTACCCATTTGACACAGAAAATGTCAATTTCCCACTATCTGGCCTGTGCTTTGTTGGTCTTATCTCCATGATTGATCCTCCTCGCTCCAGTGTACCAGATGCCGTCATGAAGTGCCGCAGCTCTGGAATCAAAGTTATCATGGTGACTGGTGACCACCCAATTACAGCAAAAGCAATTGCACGGTGTGTAGGAATCATTTCAAGCACAAGTGAAACAGTTGAAGATATTGCAGAGCGACTGGGAATCCCCGTTGAGCAAGTGAATCCCAGGGAAGCATGTGCTTGTGTGGTGAACGGTGGCGAGATAATCGACATGACCTCAGATGAACTTGATGACGTCTTGAGACATCACCAGGAAATTGTGTTTGCCAGGACATCACCACAACAGAAGCTTCTAATCGTAGAGGGTTGTCAAAGACTGGGAGCCATTGTGGCTGTAACTGGGGATGGAGTGAATGACTCTCCAGCTCTGAAGAAAGCAGATATTGGTGTTGCCATGGGAATAGCTGGCTCTGATGCTGCAAAACATTCGGCGGATATGATTCTTTTGGATGACAACTTTGCTTCCATTGTCACAGGAGTGGAAGAAGGTCGGCTGATATTTGACAACCTAAAGAAGTCAATTTCATATACAGTGACCAAGAACATCCCAGAAATGATCCCTTTCATGGTCTATGTAATTATCAGCTGTCCATTACCACTGGGTACCATCACCATCCTTTTCATTGAACTGGGCACTGACATTATCCCATCTATAGCTTTAGCATATGAGAAAGCAGAGAATGATATTATGTTAAGAAAACCACGCAACCCGCGCAAAGATCGACTGGTGAACCAGCAGTTACTGACATATTCCTATTTTCACATAGCTGCAATGGAATCGTATGCTGGATTTGTGAATTATTTCACAGTAATGGCTCAGCAGGGCTTCCTTCCAATTACATTAATTGGACTTCGTGCTCCATGGGAGGACAAAAATATTCAGGAGTTGGAGGACAGTTATGGCCAGGAATGGACATACACGCAACGTCTCCATCAGGAGTGGTATTGTTACTCGGCCTTCTTTATCAGTATTGTTGTCTGCCAGATGATGAACACATGTATTCGCAAAACAAGGAGAAACACCATCTTGTCTCGAAATTTCTTCAGAAATAAAGTTATATTCATCGGGCTGCTGTCACAAGTTGCTATTGGTGTTTTCCTATGTTATTGCCCTGGAATGGATGATGCTCTGCACTTTATGCCTATTCGAGTCCAGTACTGGTTTGTGTCTATTGAATATACAATCCTCATTTTGGTTTATGATGAACTCAGAAAACTTCTCATTCGAACATTTCCAGGCAGTTGGGTGGATAAGGAGCTTTATTACTAA
Full Trace Sequence: gcctgggtgaattattcatcctcctgcagtgtctctgcttggaaagctataaacttcttctactccccgtatttgggaacaccaagctgcaagaatgtcttcagagaaaccacctgagccttacatagtgcccatggacgatcaaaaggctaacacagagaagaaaaaaaataagctgtttgggaaaaaaaaggggaataagtctggcaaaaaagtggacaccttgaaaaaggaactagaaattaatgaccacaatttaagtattgaagaactggaaaagaaatataatgtggatataaaagtgggtcagccccagcaaactgcagatgaactctttgctcgagatggtcctaacaggctaagtcctccaaagggaacccctgaaatcgtcaagtttatgctgttgatggctggtggcttttctattgtcttctggattggttcgatattgtgcttcattgcatatggactccaggttgcacaggaccccactgtctccaaagacaatctctggttggccctcattctaattgctgtggtggttatgacagcgttatttgcctattatcaggaagccaaaagcacaaacatcatggctggctttaagaacatggttccccagcaagctttggttcttcgggatggcaagcgagtagaattggttgcagagaaactcgtagttggagacatcgttttcattaaaggaggagacaaaatccctgctgacttaaggatgttggagagtgcggggtgcaaggttgataactcatcactgactggggagtcggagccccaggcccgaggtaccgagtgcactgatgaaaatcctttggaaacgaagaatttagcctttttctctacaacctgcttggagggaacagcatctggcattgtaattaacactggggaccgcacagtgattggccgtattgctaatctggcttcccaagttggaaatcagaaaacacctattgctctggagattgaacacttcgtacacatgatcagtggcctcgctgtgggagtcggaatcctcttcttcatcatctccatttccatgggttacagcgctctcaatgccataatattctgcattggtattgtggtggcatatgtacctgaaggattactggccacagtcactgtctgtctttcactcactgcaaaacgaatggccaagaaaaactgcctggtcaagaatcttgaggctgtggagactcttgggtccacctctgtcatttgctctgacaagactggcaccttgacacaaaaccgtatgaccgtggcacacatgtggtttgacaacatcatccacaatgctgacactacagaggatcagagtggggaggcatttgatcagagctcccctagctggaaggcacttttaagaattgccactctttgcaatcgtgcagaattccttgcctgtgcagaggatgtgcccatcaataagagacaagtaaatggagacgcatcagaagccgctttattaaagttctcagaacaacttcaaggtaacgtgtcagatgtcagagcaagaaacaagaaagtgtcagaaattccatttaattcaagtaacaaataccaggtctccattcacataccagaaaacccagcagaaaaaggctacctgttggtaatgaaaggggcacctgaacggatcctggatcgatgtgaaactatcatgatagcaggacaggaatggcctcttgatgaagaaatgaaagaaaatttccagaatgcatacatgacacttggaggccttggggaaagagttttagggttctgtcaactctcactgccccatgatgtctatggaccaggttacccatttgacacagaaaatgtcaatttcccactatctggcctgtgctttgttggtcttatctccatgattgatcctcctcgctccagtgtaccagatgccgtcatgaagtgccgcagctctggaatcaaagttatcatggtgactggtgaccacccaattacagcaaaagcaattgcacggtgtgtaggaatcatttcaagcacaagtgaaacagttgaagatattgcagagcgactgggaatccccgttgagcaagtgaatcccagggaagcatgtgcttgtgtggtgaacggtggcgagataatcgacatgacctcagatgaacttgatgacgtcttgagacatcaccaggaaattgtgtttgccaggacatcaccacaacagaagcttctaatcgtagagggttgtcaaagactgggagccattgtggctgtaactggggatggagtgaatgactctccagctctgaagaaagcagatattggtgttgccatgggaatagctggctctgatgctgcaaaacattcggcggatatgattcttttggatgacaactttgcttccattgtcacaggagtggaagaaggtcggctgatatttgacaacctaaagaagtcaatttcatatacagtgaccaagaacatcccagaaatgatccctttcatggtctatgtaattatcagctgtccattaccactgggtaccatcaccatccttttcattgaactgggcactgacattatcccatctatagctttagcatatgagaaagcagagaatgatattatgttaagaaaaccacgcaacccgcgcaaagatcgactggtgaaccagcagttactgacatattcctattttcacatagctgcaatggaatcgtatgctggatttgtgaattatttcacagtaatggctcagcagggcttccttccaattacattaattggacttcgtgctccatgggaggacaaaaatattcaggagttggaggacagttatggccaggaatggacatacacgcaacgtctccatcaggagtggtattgttactcggccttctttatcagtattgttgtctgccagatgatgaacacatgtattcgcaaaacaaggagaaacaccatcttgtctcgaaatttcttcagaaataaagttatattcatcgggctgctgtcacaagttgctattggtgttttcctatgttattgccctggaatggatgatgctctgcactttatgcctattcgagtccagtactggtttgtgtctattgaatatacaatcctcattttggtttatgatgaactcagaaaacttctcattcgaacatttccaggcagttgggtggataaggagctttattactaaaggatctaaagctaaaacacctaatgaaaaaccttcactcatggaagatccttttattttcatgtgtttttcaccaatgtaaaatatgtatatatgtatagaatatatgtacaaaatgctttgtaaatatatcttttttaaataatttaattgttctacaaccagttgctatccttcttttccaaaccccatctcctaagttgtaaacatcattaaaaactaataaaaaatttaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSSEKPPEPYIVPMDDQKANTEKKKNKLFGKKKGNKSGKKVDTLKKELEINDHNLSIEELEKKYNVDIKVGQPQQTADELFARDGPNRLSPPKGTPEIVKFMLLMAGGFSIVFWIGSILCFIAYGLQVAQDPTVSKDNLWLALILIAVVVMTALFAYYQEAKSTNIMAGFKNMVPQQALVLRDGKRVELVAEKLVVGDIVFIKGGDKIPADLRMLESAGCKVDNSSLTGESEPQARGTECTDENPLETKNLAFFSTTCLEGTASGIVINTGDRTVIGRIANLASQVGNQKTPIALEIEHFVHMISGLAVGVGILFFIISISMGYSALNAIIFCIGIVVAYVPEGLLATVTVCLSLTAKRMAKKNCLVKNLEAVETLGSTSVICSDKTGTLTQNRMTVAHMWFDNIIHNADTTEDQSGEAFDQSSPSWKALLRIATLCNRAEFLACAEDVPINKRQVNGDASEAALLKFSEQLQGNVSDVRARNKKVSEIPFNSSNKYQVSIHIPENPAEKGYLLVMKGAPERILDRCETIMIAGQEWPLDEEMKENFQNAYMTLGGLGERVLGFCQLSLPHDVYGPGYPFDTENVNFPLSGLCFVGLISMIDPPRSSVPDAVMKCRSSGIKVIMVTGDHPITAKAIARCVGIISSTSETVEDIAERLGIPVEQVNPREACACVVNGGEIIDMTSDELDDVLRHHQEIVFARTSPQQKLLIVEGCQRLGAIVAVTGDGVNDSPALKKADIGVAMGIAGSDAAKHSADMILLDDNFASIVTGVEEGRLIFDNLKKSISYTVTKNIPEMIPFMVYVIISCPLPLGTITILFIELGTDIIPSIALAYEKAENDIMLRKPRNPRKDRLVNQQLLTYSYFHIAAMESYAGFVNYFTVMAQQGFLPITLIGLRAPWEDKNIQELEDSYGQEWTYTQRLHQEWYCYSAFFISIVVCQMMNTCIRKTRRNTILSRNFFRNKVIFIGLLSQVAIGVFLCYCPGMDDALHFMPIRVQYWFVSIEYTILILVYDELRKLLIRTFPGSWVDKELYY
Donor tissue: tailbud