ORFeome > atp5b – XORFeome 2.0

atp5b – XORFeome 2.0

General Information

Species: Xenopus tropicalis ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide, mRNA (cDNA clone MGC:76033 IMAGE:5384921), complete cds
Gene Symbol: atp5b
Gene ID: 407968
ORF gb_acc: MG133517
ORF ID: 11042

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067388

Library Location

Plate ID: GDExt11010
Well Location: F05

EST Sequences

Clone: MGC:76033 IMAGE:5384921
Trimmed Sequence: ATGTTAGGGGCTGTAGGACGTTGTTCTGCGGGGGCACTGCGGGCTCTAAAGCCAGCATCTAACCCAGTTCAGCTCGGGCAGAACCTTCTCAGATGTTCCCCTGCAGCGCTGCACTCCCGGAGAGATTATGCAGCTCAGACTTCCGCAGCAGCCAAGCCTGGAACAGCAGTCGGCCGCATTGTGGCAGTCATTGGTGCTGTTGTTGATGTCCAGTTTGATGAAGGCCTCCCACCTATCCTGAATGCCTTGGAGGTCCAGGGCAGAGACACCAGGCTTGTGCTGGAAGTTGCACAGCATCTGGGTGAAAACACTGTCCGAACAATTGCTATGGATGGCACAGAAGGTTTGGTCAGAGGGCAGAAAGTCCTTGATGCTGGCACACCAATCCGAATTCCTGTTGGTCCTGAGACCCTTGGAAGAATCATGAATGTAATTGGTGAACCCATTGATGAAAGAGGGCCTATTACTACCAAACAGTTTGCAGCCATCCATGCAGAAGCCCCAGAGTTTGTGGAGATGAGCGTTGAGCAGGAAATCTTGGTTACTGGCATTAAAGTTGTAGATCTGCTGGCGCCCTATGCCAAAGGAGGAAAAATTGGTCTGTTTGGTGGTGCAGGAGTAGGTAAAACTGTGCTAATTATGGAGCTGATCAACAATGTAGCCAAAGCTCATGGTGGTTACTCTGTGTTTGCTGGAGTTGGAGAGCGTACACGTGAAGGAAATGATTTGTATCATGAAATGATTGAATCTGGAGTAATCAACTTGAAGGATACAACATCAAAGGTCGCACTGGTATATGGGCAGATGAACGAGCCCCCAGGTGCCAGAGCTCGTGTTGCTTTAACTGGTCTGACTGTTGCTGAATATTTCAGAGATCAAGAGGGACAAGATGTGTTGCTTTTTATTGACAACATTTTCAGGTTTACCCAGGCTGGTTCAGAGGTGTCTGCCTTGCTGGGACGTATCCCCTCTGCTGTCGGTTACCAGCCAACTCTGGCCACTGACATGGGTACCATGCAAGAGAGAATTACAACTACAAAGAAAGGGTCAATTACATCTGTGCAGGCCATTTATGTACCTGCTGATGACTTGACTGACCCAGCTCCTGCTACCACCTTTGCCCATTTGGACGCTACTACAGTATTGTCTCGTGCTATTGCTGAGTTGGGTATTTATCCTGCTGTGGATCCTCTGGACTCAACATCTCGTATCATGGATCCCAACATTGTGGGGCTGGAACATTATGAGGTTGCTCGTGGTGTACAAAAAATACTCCAGGACTATAAATCACTGCAGGATATCATTGCCATCTTGGGTATGGATGAGTTATCAGAGGAAGACAAACTGACTGTAGCCCGTGCTCGCAAGATCCAGCGTTTCCTCTCCCAACCTTTCCAAGTAGCTGAGGTCTTCACTGGACATCTTGGTAAACTGGTCCCATTAAAAGATACCATCAAGGGATTCAAGCAGATCCTCCACGGTGGATATGATAATCTTCCAGAACAGGCTTTCTACATGGTAGGCCCGATTGAAGAAGCTGTAACAAAGGCTGAAAAACTTGCAGAAGAGCACTCTTAA
Full Trace Sequence: cgccgccatgttaggggctgtaggacgttgttctgcgggggcactgcgggctctaaagccagcatctaacccagttcagctcgggcagaaccttctcagatgttcccctgcagcgctgcactcccggagagattatgcagctcagacttccgcagcagccaagcctggaacagcagtcggccgcattgtggcagtcattggtgctgttgttgatgtccagtttgatgaaggcctcccacctatcctgaatgccttggaggtccagggcagagacaccaggcttgtgctggaagttgcacagcatctgggtgaaaacactgtccgaacaattgctatggatggcacagaaggtttggtcagagggcagaaagtccttgatgctggcacaccaatccgaattcctgttggtcctgagacccttggaagaatcatgaatgtaattggtgaacccattgatgaaagagggcctattactaccaaacagtttgcagccatccatgcagaagccccagagtttgtggagatgagcgttgagcaggaaatcttggttactggcattaaagttgtagatctgctggcgccctatgccaaaggaggaaaaattggtctgtttggtggtgcaggagtaggtaaaactgtgctaattatggagctgatcaacaatgtagccaaagctcatggtggttactctgtgtttgctggagttggagagcgtacacgtgaaggaaatgatttgtatcatgaaatgattgaatctggagtaatcaacttgaaggatacaacatcaaaggtcgcactggtatatgggcagatgaacgagcccccaggtgccagagctcgtgttgctttaactggtctgactgttgctgaatatttcagagatcaagagggacaagatgtgttgctttttattgacaacattttcaggtttacccaggctggttcagaggtgtctgccttgctgggacgtatcccctctgctgtcggttaccagccaactctggccactgacatgggtaccatgcaagagagaattacaactacaaagaaagggtcaattacatctgtgcaggccatttatgtacctgctgatgacttgactgacccagctcctgctaccacctttgcccatttggacgctactacagtattgtctcgtgctattgctgagttgggtatttatcctgctgtggatcctctggactcaacatctcgtatcatggatcccaacattgtggggctggaacattatgaggttgctcgtggtgtacaaaaaatactccaggactataaatcactgcaggatatcattgccatcttgggtatggatgagttatcagaggaagacaaactgactgtagcccgtgctcgcaagatccagcgtttcctctcccaacctttccaagtagctgaggtcttcactggacatcttggtaaactggtcccattaaaagataccatcaagggattcaagcagatcctccacggtggatatgataatcttccagaacaggctttctacatggtaggcccgattgaagaagctgtaacaaaggctgaaaaacttgcagaagagcactcttaaagacttatttctattttcctcatgcacttcaatgaaaccttcatcctcaaagtaacacttaatgcctgtatctgtcttgagttatgttggcaaagtgtatttaaagtttccaataaaacatccgtgtaaagaccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MLGAVGRCSAGALRALKPASNPVQLGQNLLRCSPAALHSRRDYAAQTSAAAKPGTAVGRIVAVIGAVVDVQFDEGLPPILNALEVQGRDTRLVLEVAQHLGENTVRTIAMDGTEGLVRGQKVLDAGTPIRIPVGPETLGRIMNVIGEPIDERGPITTKQFAAIHAEAPEFVEMSVEQEILVTGIKVVDLLAPYAKGGKIGLFGGAGVGKTVLIMELINNVAKAHGGYSVFAGVGERTREGNDLYHEMIESGVINLKDTTSKVALVYGQMNEPPGARARVALTGLTVAEYFRDQEGQDVLLFIDNIFRFTQAGSEVSALLGRIPSAVGYQPTLATDMGTMQERITTTKKGSITSVQAIYVPADDLTDPAPATTFAHLDATTVLSRAIAELGIYPAVDPLDSTSRIMDPNIVGLEHYEVARGVQKILQDYKSLQDIIAILGMDELSEEDKLTVARARKIQRFLSQPFQVAEVFTGHLGKLVPLKDTIKGFKQILHGGYDNLPEQAFYMVGPIEEAVTKAEKLAEEHS
Donor tissue: gastrula