ORFeome > atp6v1e1 – XORFeome 2.0

atp6v1e1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E, mRNA (cDNA clone MGC:75761 IMAGE:5381710), complete cds
Gene Symbol: atp6v1e1
Gene ID: 394728
ORF gb_acc: MG132913
ORF ID: 10279

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061292

Library Location

Plate ID: GDExt11003
Well Location: D11

EST Sequences

Clone: MGC:75761 IMAGE:5381710
Trimmed Sequence: ATGGCGCTGAGCGATGCAGACGTGCAGAAGCAGATCAAGCACATGATGGCTTTCATCGAGCAGGAAGCCAATGAGAAGGCGGAAGAAATAGATGCCAAGGCAGAAGAGGAGTTTAACATTGAGAAGGGCCGACTGGTGCAGACCCAGAGACTGAAGATCATGGAGTATTATGAGAAGAAAGAGAAACAGATCGAGCAACAAAAGAAAATTCAGATGTCAAACCTGATGAACCAAGCCCGTCTGAAGGTGCTGAAAGCTCGCGATGATCACATTTCGGAGTTGCTGAATGAGGCCAGACAGAGACTCTCTCGGGTAGTGAAGGACACGGCTCGGTACCAGATGCTGCTGGACGGACTCATCCTGCAGGGTTTGTTCCAACTCCTGGAGCCCAGGGTGCTGATACGCTGCCGTAAGCAAGACTTCCCTCTGATTTCGGCTTCTGTGCAGAAGAGCATCCCCACTTACAAGGCTGCTACCAAGCAAGGCGTGGAGGTGATCATTGATCAGGAGAACCACCTACCCCCCGAAATAGCCGGAGGAGTGGAGCTTTATAACGGCGATGGGAAAATCAAAGTGTCAAACACGCTGGAGAGTCGGCTGGACTTGATCGCTCAGCAGATGATGCCAGAAATCCGAGTCGCTTTATTTGGGGCCAACACTAATCGAAAGTTTATGGACTGA
Full Trace Sequence: ctgattctctccggcccttctctctctctctcacaccgagccgctaccatggcgctgagcgatgcagacgtgcagaagcagatcaagcacatgatggctttcatcgagcaggaagccaatgagaaggcggaagaaatagatgccaaggcagaagaggagtttaacattgagaagggccgactggtgcagacccagagactgaagatcatggagtattatgagaagaaagagaaacagatcgagcaacaaaagaaaattcagatgtcaaacctgatgaaccaagcccgtctgaaggtgctgaaagctcgcgatgatcacatttcggagttgctgaatgaggccagacagagactctctcgggtagtgaaggacacggctcggtaccagatgctgctggacggactcatcctgcagggtttgttccaactcctggagcccagggtgctgatacgctgccgtaagcaagacttccctctgatttcggcttctgtgcagaagagcatccccacttacaaggctgctaccaagcaaggcgtggaggtgatcattgatcaggagaaccacctaccccccgaaatagccggaggagtggagctttataacggcgatgggaaaatcaaagtgtcaaacacgctggagagtcggctggacttgatcgctcagcagatgatgccagaaatccgagtcgctttatttggggccaacactaatcgaaagtttatggactgagcgccgggggtggttggacgccggtctcactgccgcactcctggaggtggaacataagcaaagcctgaatctctttgtttcattgtatgtaactttatattgtagtcatgctcttcccttgtaagaactaggcaacaaaccaatcccgttttgtcttattggtcagtattggtgggaggcggggtcagccagcggcaggttcaagcttttcccaatttgtcattaaccacatccctctgtttgtatctaaagcggaacataacccccccagaatggattcatgcacaagtccttttctgagccctcattatttattttctactttgtttgcatgatgttggcaattttacaccgccaatatcatgaatttgcaacaaaagcatctgctgttgattcatctggtctgacagttgccgggagatgcttcctgcatcagtggcgcagccttctgcctcctgtgagcagattcatggtattagcagtgtagaacctctaacatcatgtaaactaaagggcaaaacaatgaaccccccccccccccaagaaacagaacctttctaggaacttcctgctgaaataggaagtcagactgaaagcagtgacccttagcaaccaatcagcaggtagaattgtctggtcacctgtttaaaagccaactgctcagatacctgggcatgtaactagccaatcattagctcccgctctctgccatggcaactttttaaaagggtgaacttccccttgaaatcccagaaatatatctctgccgcccatagtagccgatctgccccttaaccctttataaacgtatcaccggggcagattgggatcttgtgatcatccccacttccaagcctcggtagccgaactgcccgttggtggcccgggggctgatgggatatttttgtttacaataaatgctcagatctgggtaatagactgtaattaaaatcggttttatttgtgggtaagcgctggctacaccgtgcgccccccccccccgtgcagatcccgcctaccgctgcctgttacacgcatggctactcccggttttcaaacttctgtatatgtggcccccccagtaacaccatcagcctcgttattcattgtccaatgtgatgtttatttattacaataaagttgtgtggaccctgcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MALSDADVQKQIKHMMAFIEQEANEKAEEIDAKAEEEFNIEKGRLVQTQRLKIMEYYEKKEKQIEQQKKIQMSNLMNQARLKVLKARDDHISELLNEARQRLSRVVKDTARYQMLLDGLILQGLFQLLEPRVLIRCRKQDFPLISASVQKSIPTYKAATKQGVEVIIDQENHLPPEIAGGVELYNGDGKIKVSNTLESRLDLIAQQMMPEIRVALFGANTNRKFMD
Donor tissue: tadpole