ORFeome > b3gnt5 – XORFeome 2.0

b3gnt5 – XORFeome 2.0

General Information

Species: Xenopus tropicalis UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5, mRNA (cDNA clone MGC:76134 IMAGE:5309361), complete cds
Gene Symbol: b3gnt5
Gene ID: 394849
ORF gb_acc: MG132698
ORF ID: 9989

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063912

Library Location

Plate ID: GDExt11001
Well Location: G04

EST Sequences

Clone: MGC:76134 IMAGE:5309361
Trimmed Sequence: ATGCTTATTAGTGCTAGGAGGCTAAGAAGATGCCAGTTCTTTCAATTACTCACTTCATGTTTTGTTTTATCATTAATGGCTTTGTTGGTTCAAGAAGACAATTCCTTGATCAACCACGTAAAGTCGTATTCCTACAGATACCTCATAAATAGCTATGACTTTGTCAATGATAGCCTGTCTGTTCCTCGGGACAGACCCGATGGGGCACCCAGCTACAGATATCTGATCAATAACCGAGACAAATGTCAAAACGAGGATGTCCTTCTATTACTGTTTGTAAAGACATCTCCTGAAAACAGAAGGCGCCGCAATGCAATTCGAAAGACTTGGGGCAACGAGGATTACATTCGTTCTCAGTATGCTGCCAACATTAAAGTTGTGTTTGCCCTTGGTATTGAAGCAGATCCAGTAAAAAGTCATCAAACTCAAAAAGATCTTGTCATTGAAAACAAAAGATTCAACGATTTAATACAGCAAGACTTCAAGGACACTTTTCACAACCTAACTCTTAAGTTGCTTTTGCAGTTTGGGTGGGTAAATTCATACTGTCCTAGTGCTAAATTCATTATGTCAGCCGATGATGATATCTTTGTCCACACACCTAACTTGGTTTCCTACCTTAAAAGCTTGCCTATCGAAACACAGGATTTCTGGATTGGTAGAGTCCATCGTGGATCACCTCCAATAAGAAGCAAAACCAGCAAGTATTATGTGCCTTACGAAATGTATCCCTGGTCATCTTATCCCGACTACACTGCAGGGGCTGCTTATGTTGTTTCTAAAGATGTAGCTGCAAAAGTATACGAAGCGTCACAGACATTAAATACCAGTTTATACATAGATGATGTTTTCATGGGAATCTGTGCCAACAAAATGGGAGTTGTGCCTCAATATCACGTTTATTTCGCTGGAGAAGGAAAAGCCCCATACCATCCTTGTATTTACAACAAAATGATTACTTCCCATGGACATTTAGATGACCTTGACTATTTATGGAGGCAAGCTACAGACCCTAATGTAAAATCTCTTAGTGCTGGAGTTTTGGGAGGTGCATACTGTAAGTTAGTAAACATCATGCTTCTCTGTAAACTTAGCTATGTGGATACATACCCCTGTTCAGCCGCATGGTCCTAG
Full Trace Sequence: ggaagcggacttgccagcgcgttcatcgcctgctgtagctgagcgcatctatgccgcctgcctggaatcatttctgtgtgtcgatgatgtcagctaactaagacacagtagaagcatgtgccatttttgaagtcttcctggaaccgtcagcaatgcaaacgttgaaaatctgttagcctacagtgtgggtttttccattttaaggagtatttggcttttacaatgaacatttgttcaggaaatacagacattcaaagacaagctatatgaatttcaacctttttttcctcacaaaatttctaattcccccagaatgcttattagtgctaggaggctaagaagatgccagttctttcaattactcacttcatgttttgttttatcattaatggctttgttggttcaagaagacaattccttgatcaaccacgtaaagtcgtattcctacagatacctcataaatagctatgactttgtcaatgatagcctgtctgttcctcgggacagacccgatggggcacccagctacagatatctgatcaataaccgagacaaatgtcaaaacgaggatgtccttctattactgtttgtaaagacatctcctgaaaacagaaggcgccgcaatgcaattcgaaagacttggggcaacgaggattacattcgttctcagtatgctgccaacattaaagttgtgtttgcccttggtattgaagcagatccagtaaaaagtcatcaaactcaaaaagatcttgtcattgaaaacaaaagattcaacgatttaatacagcaagacttcaaggacacttttcacaacctaactcttaagttgcttttgcagtttgggtgggtaaattcatactgtcctagtgctaaattcattatgtcagccgatgatgatatctttgtccacacacctaacttggtttcctaccttaaaagcttgcctatcgaaacacaggatttctggattggtagagtccatcgtggatcacctccaataagaagcaaaaccagcaagtattatgtgccttacgaaatgtatccctggtcatcttatcccgactacactgcaggggctgcttatgttgtttctaaagatgtagctgcaaaagtatacgaagcgtcacagacattaaataccagtttatacatagatgatgttttcatgggaatctgtgccaacaaaatgggagttgtgcctcaatatcacgtttatttcgctggagaaggaaaagccccataccatccttgtatttacaacaaaatgattacttcccatggacatttagatgaccttgactatttatggaggcaagctacagaccctaatgtaaaatctcttagtgctggagttttgggaggtgcatactgtaagttagtaaacatcatgcttctctgtaaacttagctatgtggatacatacccctgttcagccgcatggtcctagtgctactgcaatagttgggcttgctttcagtttgattttttggcaaacattctttggatcctttgtggtccccacccatctgctctcaggaacacatactatttttgcttttgatgacgcttttgaagtccgttactgaacaacagtaataaatgctgaaatgtttactgtgatgcactgtatcactcatgctgtaatacgttaatggctgaattctatgttcttttcatgtccttgtttacagatttgttgtatgatatagcagtgatgttgttaaaccatgtacaagtataaagcataaagaaatccctatgagaatacagcacagtataagtttagagaagccagattggcttgctatggatgtactgcactgtctaaagctttagcagttgagggatgctgggaagtttagtttgcaacagctggagaagaaccatatgggaatccttggtctcaatctgaagctgtgggctgttactgtgccttctaatgtccagctaaaaaaaccaaaattataagtgactaagagtttttgtatttatgcatgttataggttggctgttgtggattttatcatccaaaaagctgcatttacagcaggttttaaacttagtcataaaatgataaccagttattcataggttatttactctttccacctttaggatcactgcattaaatcaggggtgggtaatctgcagctttcctaatgctgttgaactgcagtttttacatcccactggtagtgaggcagaagaatgcccttgtgttttatttaaatactggcgctttatagtatagattaaaccacttggtattttagcacagtcacaggcagggttctatataaataaagctcactagaattagaagaacttgcatactaaaaaaaaatgtgaaaaaattcagagtgaacatattttgaactacagcaggtctgttttacacacaaatatatttttatactgtattagaactgcatatttattataaaagatatgaaggtgggaaaaacaaaccacctgaattttcatacagaggaaatccttttgataactcgattttcttgtggagggattcccaactaaaatggtgctggttattggaagtgtgaggtggagaaatccttttcagttgtacatcagagcctttcagtggttctaaactagtgagctgtggatgagtgaaagacacgtgcacttgtgtatttattgtctgccgttaactgtatgttttgtgtattttttttatgttgtaaattattgctttgctcgtatgagcaattttacttttgtaaatcttttcattttcaataaactgactccataatgaaaaaaaaaaaaaaa
Translation: MLISARRLRRCQFFQLLTSCFVLSLMALLVQEDNSLINHVKSYSYRYLINSYDFVNDSLSVPRDRPDGAPSYRYLINNRDKCQNEDVLLLLFVKTSPENRRRRNAIRKTWGNEDYIRSQYAANIKVVFALGIEADPVKSHQTQKDLVIENKRFNDLIQQDFKDTFHNLTLKLLLQFGWVNSYCPSAKFIMSADDDIFVHTPNLVSYLKSLPIETQDFWIGRVHRGSPPIRSKTSKYYVPYEMYPWSSYPDYTAGAAYVVSKDVAAKVYEASQTLNTSLYIDDVFMGICANKMGVVPQYHVYFAGEGKAPYHPCIYNKMITSHGHLDDLDYLWRQATDPNVKSLSAGVLGGAYCKLVNIMLLCKLSYVDTYPCSAAWS
Donor tissue: gastrula