ORFeome > banp – XORFeome 2.0

banp – XORFeome 2.0

General Information

Species: Xenopus tropicalis BTG3 associated nuclear protein, mRNA (cDNA clone MGC:76079 IMAGE:5307801), complete cds
Gene Symbol: banp
Gene ID: 394803
ORF gb_acc: MG132734
ORF ID: 10034

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063204

Library Location

Plate ID: GDExt11001
Well Location: D02

EST Sequences

Clone: MGC:76079 IMAGE:5307801
Trimmed Sequence: ATGATGTCAGGCCAGGAACTGGCTGAAGTGGTTCAAATTGCAGTGGAAGATTTACATCCAGGCCATCATCCAGTTGTGCTGGAGAATCATGAAGTGACCGAGGAGGATTTGTCACCAACTTTGAAGCGCCAGCGAATAGAAATCAACTGCCAGGATCCATCTATTAAGTCATTTCTGTTTTCAATCAACCAGACAATTTGCTTAAGACTAGACAGCATTGAGTCCAAATTACAGGTACTTGAAGCAACATGTAAGTCATTAGAAGAAAAACTGGACCTCATAATGAACAAACAACAAAATCCAGTCCAAGTTCCAGTGGTTGCTGGTTCACCACTTGGAGCCACACAGACCTGGAATAAAGTACGATGTGTTGTACCGCAGACTACAGTAATACTGAACAGTGAAAGACAAACCCCAGGTGTGACTAAACTGGAGGGTCGCGAAGAGTCTATAAACAGTTCAACAGAAACCCTTGAAAACATGCTGAATAGTGCAGTTCCTGGAAGAAGACACAACACAATTGTAGTGAAAGTTCCTGCCCCTGAGGACAGCCACAATGATGATGACAATGACAGTGGTTCTGAGGCTAGTGATACACTGTCTAATTGCGGTAATTCAGGAAACCCAAATATGGGCAACAATGTCACCCTGATCACCTTAAATTCTGAAGAGGATTATCCTAATGGTACATGGTTGGGGGATGAACATAATCCAGAGATGAGAGTAAGAAGTCCTATAACAGCAGCTGACATGCTGCACATCAGTACCAACTGTCGAACAGCTGAAAAGATGGCGCTTACTTTACTTGATTATCTTTTCCATCGAGAAATCCAGGCTATCTCCAACTTGTCAGGCCAGGGGAAACATGGGAAAAAGCAACTGGATCCATTAATGATCTACGGAATAAGATGTCATCTATTCCATAAGTTTAGAATCACAGAGTCTGACTGGTATAGAATCAAGCAGAGCATTGATTCAAAATGCCGGACTGCCTGGCGTAGAAAACAGAGAGGTCAGAGTCTTGCAGTAAAAAGCTTTTCACGGAGAACACCCTCTTCCTCGTCATATAGCACCACAGAAGGTGTACAGAACACTGTGTCCTCATCCAGTGACTTGCAGCAAACATCGCCTCAGGCTCTGCATTATGCACTAGCCAATGCTCAGCAGGTTCAGATCCACCAGATTGGAGAGGATGGACAAGTCCAAGTGGGACATCTCCACATTGCTCAGGTGCCGCAAGGAGAGCAAGTGCAGATCACGCAAGACAGCGAGGGTAATCTGCAGATTCATCAGGTCCATGTTGGTCAGGATGGGCAGGTTCTTCAGGGAGCCCAACTGATAGCGGTAGCCTCTGCCGATCCAACTGCTGGTGTGGTTGATGGGTCACCACTTCAAGCCAATGATATTCAAGTCCAGTATGTTCAGCTTGCACCAGTCGCAGAGCCATCAGCAACAGCCCAGGCGGTAGAACCTCTACAGTCTGCACTTCAGCCAGAAATGCATATTGAACATGGGTCTATCCAGATTCAGTAG
Full Trace Sequence: ctctaagtcaggaaggaggccagaatcttgcagttaaaatctttgcgggaattgaatttccacattccttttcacaaaagcccctcttgctggatatttgctattcttccaatgatgtcaggccaggaactggctgaagtggttcaaattgcagtggaagatttacatccaggccatcatccagttgtgctggagaatcatgaagtgaccgaggaggatttgtcaccaactttgaagcgccagcgaatagaaatcaactgccaggatccatctattaagtcatttctgttttcaatcaaccagacaatttgcttaagactagacagcattgagtccaaattacaggtacttgaagcaacatgtaagtcattagaagaaaaactggacctcataatgaacaaacaacaaaatccagtccaagttccagtggttgctggttcaccacttggagccacacagacctggaataaagtacgatgtgttgtaccgcagactacagtaatactgaacagtgaaagacaaaccccaggtgtgactaaactggagggtcgcgaagagtctataaacagttcaacagaaacccttgaaaacatgctgaatagtgcagttcctggaagaagacacaacacaattgtagtgaaagttcctgcccctgaggacagccacaatgatgatgacaatgacagtggttctgaggctagtgatacactgtctaattgcggtaattcaggaaacccaaatatgggcaacaatgtcaccctgatcaccttaaattctgaagaggattatcctaatggtacatggttgggggatgaacataatccagagatgagagtaagaagtcctataacagcagctgacatgctgcacatcagtaccaactgtcgaacagctgaaaagatggcgcttactttacttgattatcttttccatcgagaaatccaggctatctccaacttgtcaggccaggggaaacatgggaaaaagcaactggatccattaatgatctacggaataagatgtcatctattccataagtttagaatcacagagtctgactggtatagaatcaagcagagcattgattcaaaatgccggactgcctggcgtagaaaacagagaggtcagagtcttgcagtaaaaagcttttcacggagaacaccctcttcctcgtcatatagcaccacagaaggtgtacagaacactgtgtcctcatccagtgacttgcagcaaacatcgcctcaggctctgcattatgcactagccaatgctcagcaggttcagatccaccagattggagaggatggacaagtccaagtgggacatctccacattgctcaggtgccgcaaggagagcaagtgcagatcacgcaagacagcgagggtaatctgcagattcatcaggtccatgttggtcaggatgggcaggttcttcagggagcccaactgatagcggtagcctctgccgatccaactgctggtgtggttgatgggtcaccacttcaagccaatgatattcaagtccagtatgttcagcttgcaccagtcgcagagccatcagcaacagcccaggcggtagaacctctacagtctgcacttcagccagaaatgcatattgaacatgggtctatccagattcagtagtctgaaccgtcaaagatcagggcaattccagaaaatgaccagtagatttgggtcggtgtagagtcgacatgttccttcagcttgcagcatgaataatgtgatcagtaaccactgcttagaatgtgcgtaggatatcaggtaccctggtcaggtaccttaacatttccatggttccttcatagaataaaacatatttactacctggtgacaattcttacggtaaaaatgtttttcagtatccaactaaaatctgaatgggacagatgaaaggaaattctttaactggtttgtacgcaacaatatgctatttttttatcttctgtattgtttatatccaaaagataaaattgcttatcagatatggaaacgtcagtggtcttcattatctgcagaattctccttttgtgtttttcctaatttccttccctagatttccccaaggttttgagatcacacttattgtatgacagaggcctactatgttatttaaagcttaacatccctaaattgtgaatattttgcaattcatattagctttgaagtaatctgtatctgctttcaatgctttgaatgacaaaaggtaaaataaaaattgtagtgaacaattataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MMSGQELAEVVQIAVEDLHPGHHPVVLENHEVTEEDLSPTLKRQRIEINCQDPSIKSFLFSINQTICLRLDSIESKLQVLEATCKSLEEKLDLIMNKQQNPVQVPVVAGSPLGATQTWNKVRCVVPQTTVILNSERQTPGVTKLEGREESINSSTETLENMLNSAVPGRRHNTIVVKVPAPEDSHNDDDNDSGSEASDTLSNCGNSGNPNMGNNVTLITLNSEEDYPNGTWLGDEHNPEMRVRSPITAADMLHISTNCRTAEKMALTLLDYLFHREIQAISNLSGQGKHGKKQLDPLMIYGIRCHLFHKFRITESDWYRIKQSIDSKCRTAWRRKQRGQSLAVKSFSRRTPSSSSYSTTEGVQNTVSSSSDLQQTSPQALHYALANAQQVQIHQIGEDGQVQVGHLHIAQVPQGEQVQITQDSEGNLQIHQVHVGQDGQVLQGAQLIAVASADPTAGVVDGSPLQANDIQVQYVQLAPVAEPSATAQAVEPLQSALQPEMHIEHGSIQIQ
Donor tissue: gastrula