ORFeome > bcat1 – XORFeome 2.0

bcat1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis branched chain aminotransferase 1, cytosolic, mRNA (cDNA clone MGC:89366 IMAGE:6988401), complete cds
Gene Symbol: bcat1
Gene ID: 448409
ORF gb_acc: MG133884
ORF ID: 11470

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075501

Library Location

Plate ID: GDExt11014
Well Location: B12

EST Sequences

Clone: MGC:89366 IMAGE:6988401
Trimmed Sequence: ATGGCAGCCACCGCAGCAGCTTTATCCGGGCTGAAGGTTCTCGGCAAACAGTTGGTCATCGCTCAACGTATCTGGCCCAGTGTCCTCTGCAGAGCTGCAAGCACCTCATTCAAGGCATCGGACCTGCAGATAGAGCTAAACAAGCAGCCCAAAGAGAAGACTGATGTGGCCAACCTCATATTTGGGAAGGCTTTCAGTGATCACATGTTGACTGTGGAATGGAGCAATGACAAGGGCTGGGGAAAGCCACAAATCAAACCATTTCAAAACCTTTCCCTTCACCCTGCTACCTCTGCTCTGCACTACTCCGTGGAGCTCTTTGAAGGAATGAAAGCTTATAGAGGGGAGGACAATCACATCCGGCTTTTTCGGCCTATGTTAAACATGGAGAGGATGCACAGAACTGCCCTTCGAGCATGTCTACCTTCCTTTGACAAGGCAGAGCTCCTTGAGTGCCTGAGAAAACTCATTGAAATTGACCAGGATTGGGTTCCTCGTTCCACTTCGGCCAGTCTCTATATCAGGCCCACCTTCATTGGCACAGAGCCTTCACTCGGAGTCACAAAGTCCACTCACGCACTGCTGTATATCATTCTTTCACCCGTGGGACCCTACTTTGCAGGTGGTGGCTTTTGCCCAGTGTCCCTTCTAGCTGATCCTCAATATGTACGCGCCTGGATAGGGGGTGTAGGCAACTGCAAACTGGGTGGGAATTATGGTCCAACGATATTTGTGCAGAACGAAGCAATCAAGGTTGGATGCCAGCAGGTTCTCTGGCTCTATGGGGATGACCATAAGGTGACTGAAGCTGGCACTATGAATTTCTTCATGTACTGGATTAACGAACATCAAGAGGTAGAATTGCTGACCCCTCCTCTGGATGGTTTAATCCTTCCTGGTGTGACCAGACAAAGCCTGCTGGATTTGGCACGGAAATGGGGGGATTTCAAAGTTTCCGAACGGTCGGTCACAATGAGTGAAGTTATCAAAGGCCTGCAGGAGAACCGCGTAAAGGAAGTGTTTGGCGCAGGAACAGCCTGTGTGGTCTGCCCAATAAAGAGCATTCTCTATCAGGGAACGAATTATGCCTTACCTACCATGGAGAATGGACCAGATGTTGCAAAGAGGTTTCTAAATGAGCTCACTGACATTCAGTATGGGCGCACTCCCAGTGACTGGTCATACCTCGTTTGA
Full Trace Sequence: caagcgcacacacctgaaccatggcagccaccgcagcagctttatccgggctgaaggttctcggcaaacagttggtcatcgctcaacgtatctggcccagtgtcctctgcagagctgcaagcacctcattcaaggcatcggacctgcagatagagctaaacaagcagcccaaagagaagactgatgtggccaacctcatatttgggaaggctttcagtgatcacatgttgactgtggaatggagcaatgacaagggctggggaaagccacaaatcaaaccatttcaaaacctttcccttcaccctgctacctctgctctgcactactccgtggagctctttgaaggaatgaaagcttatagaggggaggacaatcacatccggctttttcggcctatgttaaacatggagaggatgcacagaactgcccttcgagcatgtctaccttcctttgacaaggcagagctccttgagtgcctgagaaaactcattgaaattgaccaggattgggttcctcgttccacttcggccagtctctatatcaggcccaccttcattggcacagagccttcactcggagtcacaaagtccactcacgcactgctgtatatcattctttcacccgtgggaccctactttgcaggtggtggcttttgcccagtgtcccttctagctgatcctcaatatgtacgcgcctggatagggggtgtaggcaactgcaaactgggtgggaattatggtccaacgatatttgtgcagaacgaagcaatcaaggttggatgccagcaggttctctggctctatggggatgaccataaggtgactgaagctggcactatgaatttcttcatgtactggattaacgaacatcaagaggtagaattgctgacccctcctctggatggtttaatccttcctggtgtgaccagacaaagcctgctggatttggcacggaaatggggggatttcaaagtttccgaacggtcggtcacaatgagtgaagttatcaaaggcctgcaggagaaccgcgtaaaggaagtgtttggcgcaggaacagcctgtgtggtctgcccaataaagagcattctctatcagggaacgaattatgccttacctaccatggagaatggaccagatgttgcaaagaggtttctaaatgagctcactgacattcagtatgggcgcactcccagtgactggtcatacctcgtttgataacaaatgggcctctgtcagatccggcattcctgagcaatacaatcacagaccttcctggagttttatttataaggattttattgtaccggggggagggtggataatggagacgacaagtgaggagttactacctctgtttccatagctgcttccactcccttctctcacccgtcctccattccttttaagcgccgggatgtggctgacagctgactttttgtattttaataatggtgcaaaacaggatactacttgtgctcttagctggattagaaatgtgaatagaaacccatgactagttgctatagaagttgtgggaatattgcctttagggtttctgtatatacgtatatatactgtacactccatagtcctcaacaagggccaagcgtcccttcttcccgtaattcatagcagccaatcagctgttagaattaggaaacccaatgcctgataggctgctatgcttacaggactagggcaaactgttaattggtttgtgcatatccttaatgtgcaaaccaagcttttatttaccttataccctttgaggtcaaaatggtgttttccctctgctattaaaacgcacaaaactgtcacactgtgcacaagttaatgtgacatttctttgcattaaaaaaagttatttactgttagaaaaaaaggagcaaattcattggggaaaatggttatattatctgatggtccagcagtataaatatttttgtgcagttgaatgtatataaatatatgtaacctgtgtattaaaaaaaaaaaaaaaaaa
Translation: MAATAAALSGLKVLGKQLVIAQRIWPSVLCRAASTSFKASDLQIELNKQPKEKTDVANLIFGKAFSDHMLTVEWSNDKGWGKPQIKPFQNLSLHPATSALHYSVELFEGMKAYRGEDNHIRLFRPMLNMERMHRTALRACLPSFDKAELLECLRKLIEIDQDWVPRSTSASLYIRPTFIGTEPSLGVTKSTHALLYIILSPVGPYFAGGGFCPVSLLADPQYVRAWIGGVGNCKLGGNYGPTIFVQNEAIKVGCQQVLWLYGDDHKVTEAGTMNFFMYWINEHQEVELLTPPLDGLILPGVTRQSLLDLARKWGDFKVSERSVTMSEVIKGLQENRVKEVFGAGTACVVCPIKSILYQGTNYALPTMENGPDVAKRFLNELTDIQYGRTPSDWSYLV
Donor tissue: gastrula