ORFeome > blzf1 – XORFeome 2.0

blzf1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis blzf1 protein, mRNA (cDNA clone MGC:79576 IMAGE:6978810), complete cds
Gene Symbol: blzf1
Gene ID: 493403
ORF gb_acc: MG133639
ORF ID: 11187

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080924

Library Location

Plate ID: GDExt11011
Well Location: F06

EST Sequences

Clone: MGC:79576 IMAGE:6978810
Trimmed Sequence: ATGGAGAAGTTAAAAACTTTGGCATCCTCACCTCCTCTCCGAGGAACAGGTGATGGCATGGAAACAGAAGTACCTTTGAAATCGGAAGTTAATTCATCTTGCACTAAGACAGCTCAAAGCCCAAGAAAGAAAACCACTGTATCACCATCGCTAAGCCCAGGGGTACTTCAACTGGGAAAAATTCAAAGTGACAAAGCTGTTGAAATCGAAGCTATCCGGATACTAATACCAAAAGCAGCCATTACACATACATCAATGACTAAGAATTCTAAACACCTAGAATCAAATGGACACAGCACAACAGAACTAGCAGAGAGTGTCACTGATCCCTGGAAACAACTGTCTGAACTTAAAAGCACCCTAGAAAAGTTAAAGAATTCAGAGAGAAGATTATTGCAAGACAAAGAAGGTCTTGCCAACCAGCTTAAAGTTCAGACTGAGGTAAATCGGGAGTTGAAAAAGTTGCTTGTGGCCTCTGTAGGAGATGATTTGCAGTATCACTTTGAGCGTATGGCTCGAGAGAAGAACCAGCTTATCTTAGAAAATGAGGTTTTGGGCAAGAATACAGCTCAGCTCTCGGAGCAGCTTGAACGCATGTCTATACAGTGTGACGTGTGGCGCAGCAAGTTCCTTGCAAGTCGAGTAATGGCGGATGAACTGACCAACATGAGGACAAATCTACAACGACAAAACAGAGATGCCCAAAGTGCCCTTCAGGATTTGCTGAGTGAAAGGGAGCGGCTCCGCCATGAAATGTCTGAAACACAAAAAACATTAGAAGAGCTGTTGGACTCTCTGCAGTGGGGAAGACAAAAAATATATGCACCAATTCCTCAACCTCACACAACTACAGAACTTATTGCAGCCAACCTCAAACTAGCAAAAGCTATACAATCCCACCTGATTGGAAATACTGGATCGGACCACCAAAAACCAGCCGCAAAGCCAATAGAGTATTGCAGCACTCCTGCAGAAAATATGGCTGAAATGTTGTTGAAAGTTCTGGATCCAGTTTCCTGCACCGATGGTTCACCAGACATCCCGTTTTCAGATTCTTCATCCTTTCTAGTAGCAAAGCAAAATATTGGCCGGTTTCACCCATACACCAGATATGAAAATATCACATTCAACTGCTGTGATCGGTGCAGAGGAGAACTGATCGCTGTATAA
Full Trace Sequence: gctgtttcttggatagtttcctggaggttgtctgatagcagaggagtccatctgcctctacaagtacaaagctactatcaaaatacctaagctcaggaatggcagccaccatggagaagttaaaaactttggcatcctcacctcctctccgaggaacaggtgatggcatggaaacagaagtacctttgaaatcggaagttaattcatcttgcactaagacagctcaaagcccaagaaagaaaaccactgtatcaccatcgctaagcccaggggtacttcaactgggaaaaattcaaagtgacaaagctgttgaaatcgaagctatccggatactaataccaaaagcagccattacacatacatcaatgactaagaattctaaacacctagaatcaaatggacacagcacaacagaactagcagagagtgtcactgatccctggaaacaactgtctgaacttaaaagcaccctagaaaagttaaagaattcagagagaagattattgcaagacaaagaaggtcttgccaaccagcttaaagttcagactgaggtaaatcgggagttgaaaaagttgcttgtggcctctgtaggagatgatttgcagtatcactttgagcgtatggctcgagagaagaaccagcttatcttagaaaatgaggttttgggcaagaatacagctcagctctcggagcagcttgaacgcatgtctatacagtgtgacgtgtggcgcagcaagttccttgcaagtcgagtaatggcggatgaactgaccaacatgaggacaaatctacaacgacaaaacagagatgcccaaagtgcccttcaggatttgctgagtgaaagggagcggctccgccatgaaatgtctgaaacacaaaaaacattagaagagctgttggactctctgcagtggggaagacaaaaaatatatgcaccaattcctcaacctcacacaactacagaacttattgcagccaacctcaaactagcaaaagctatacaatcccacctgattggaaatactggatcggaccaccaaaaaccagccgcaaagccaatagagtattgcagcactcctgcagaaaatatggctgaaatgttgttgaaagttctggatccagtttcctgcaccgatggttcaccagacatcccgttttcagattcttcatcctttctagtagcaaagcaaaatattggccggtttcacccatacaccagatatgaaaatatcacattcaactgctgtgatcggtgcagaggagaactgatcgctgtataacagcatacgatagtcgttgctctccctttttgcagttgcagtattccgctgctgtgggcttatacatgccattcttaagattcacagcacagcaatagatttaaatccaaagacttgatcaattaataataaaaataaattgtattttagatctatcatgttttataataaattatttgataatgattttggtgtaatagtcataaacataaacggtttacaaatagtgcaatacccaacactgggcaggtttatttattcactaataactatgtttttctctacttgagcatattacagtgttaagtgcaaagcttgcttaagtataaaactgtggattctgttacagcgacatgttaaaaaataaaatacacacacaaacaaaaaaaaaaaaaaaaaaa
Translation: MEKLKTLASSPPLRGTGDGMETEVPLKSEVNSSCTKTAQSPRKKTTVSPSLSPGVLQLGKIQSDKAVEIEAIRILIPKAAITHTSMTKNSKHLESNGHSTTELAESVTDPWKQLSELKSTLEKLKNSERRLLQDKEGLANQLKVQTEVNRELKKLLVASVGDDLQYHFERMAREKNQLILENEVLGKNTAQLSEQLERMSIQCDVWRSKFLASRVMADELTNMRTNLQRQNRDAQSALQDLLSERERLRHEMSETQKTLEELLDSLQWGRQKIYAPIPQPHTTTELIAANLKLAKAIQSHLIGNTGSDHQKPAAKPIEYCSTPAENMAEMLLKVLDPVSCTDGSPDIPFSDSSSFLVAKQNIGRFHPYTRYENITFNCCDRCRGELIAV
Donor tissue: tailbud