ORFeome > brp16 – XORFeome 2.0

brp16 – XORFeome 2.0

General Information

Species: Xenopus tropicalis brp16 protein, mRNA (cDNA clone MGC:79701 IMAGE:6981046), complete cds
Gene Symbol: brp16
Gene ID: 493297
ORF gb_acc: MG133680
ORF ID: 11235

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080354

Library Location

Plate ID: GDExt11012
Well Location: E05

EST Sequences

Clone: MGC:79701 IMAGE:6981046
Trimmed Sequence: ATGGATCCTGCCCTGTGCTTGGAGCTTCTCTCTTTCCTGAAGCCGGAGACCCGCGCGGATGTTCGAGCGCAGGCGTTAGAGTACATTCTGGGTGTGAGTGGGAGCCCCGAGGGGAGACAGAGCTTGTGCGCTGAGCCCCGGCTGCTTTGTGCCCTCCTGGATCTGAGCACAGAGCAGTCGCCACACGTTGCCCAGGATGCCCACCATGTGCTGGTGAATCTGACGTCAGACTGTGCCGCCCACAGAGCCCTATTGGCTCACGTTCCCACGCTCCTCCCCTCCATGCTGAGCCGCCTGCGGGATCCTGGCTGCCCATTCGCCGACTCAATCTGCACGGCGCTCTGCAACCTGAGCCGCGAGGAGGAGACTTGCCAGTCGTTCCTGCGCTCTCTCACCCAGGAGGGTATGTGCCAACTGCTGGACATGCTGTGTGCCCCCAAGTACAACCCCCGGGCATCGCTGGACTACCTGGGGCCCCTCCTGTGCAACCTGACCCAGCTGCCCGAGGGCCGACATTTCATACTGGATAGAAACAGGTGTGTGGTTCAGCGGCTGCTCCCGTATCTGCAGTCTGGATCCACAGTGCGGAGAGGGGGAATTGTGGGAACTCTGAGAAACTGCTGCTTCAGCCACCGAGACCACGCCTGGCTGCTCGGAGATGATGTGGATTTGCTGCCGTTCCTGTTGCTGCCATTGGCTGGGGGGGAGGAATTCACAGAGGAGGAGATGGAAACTCTGCCCCCCGACCTGCAGTACCTGGCGGAGGACAAACAGCGAGAGGCCGACCCCGACATTCGCAAGATGCTCATTGAGACTGTCCTGCTGCTGTGCGCGACTGCTGATGGGCGGCGCCTTGTCAAACAGAGAGGGACCTACCTGGTAATGAGAGAGTTGCACTCGTGGGAGAGAGAGCCGTGTGTGAAGAGAGCGTGCGAGAAGCTCATACAGATGCTGATTGGGGAGGAGCCAGAGGCGGGATTAGAGAATCTCCTTGAAGTGACCGTCCCACCCGACCTGGAAGAGACCCTCAGCCGCCTGGATAAGGAAGAGGAGGGGCCACAGGGGACTTTGGTGCAATAG
Full Trace Sequence: aaatagagccggaagtacaaacacgtgagggaagagagaggagtctgggttttgcagtccggcccttgttgccatggatcctgccctgtgcttggagcttctctctttcctgaagccggagacccgcgcggatgttcgagcgcaggcgttagagtacattctgggtgtgagtgggagccccgaggggagacagagcttgtgcgctgagccccggctgctttgtgccctcctggatctgagcacagagcagtcgccacacgttgcccaggatgcccaccatgtgctggtgaatctgacgtcagactgtgccgcccacagagccctattggctcacgttcccacgctcctcccctccatgctgagccgcctgcgggatcctggctgcccattcgccgactcaatctgcacggcgctctgcaacctgagccgcgaggaggagacttgccagtcgttcctgcgctctctcacccaggagggtatgtgccaactgctggacatgctgtgtgcccccaagtacaacccccgggcatcgctggactacctggggcccctcctgtgcaacctgacccagctgcccgagggccgacatttcatactggatagaaacaggtgtgtggttcagcggctgctcccgtatctgcagtctggatccacagtgcggagagggggaattgtgggaactctgagaaactgctgcttcagccaccgagaccacgcctggctgctcggagatgatgtggatttgctgccgttcctgttgctgccattggctgggggggaggaattcacagaggaggagatggaaactctgccccccgacctgcagtacctggcggaggacaaacagcgagaggccgaccccgacattcgcaagatgctcattgagactgtcctgctgctgtgcgcgactgctgatgggcggcgccttgtcaaacagagagggacctacctggtaatgagagagttgcactcgtgggagagagagccgtgtgtgaagagagcgtgcgagaagctcatacagatgctgattggggaggagccagaggcgggattagagaatctccttgaagtgaccgtcccacccgacctggaagagaccctcagccgcctggataaggaagaggaggggccacaggggactttggtgcaatagccactgggcaaccttgggactaataggtggttcctcgccaagccacggaactctgtgcattctcattggtcgaggctgatacaataaatcagccaagttgctcttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDPALCLELLSFLKPETRADVRAQALEYILGVSGSPEGRQSLCAEPRLLCALLDLSTEQSPHVAQDAHHVLVNLTSDCAAHRALLAHVPTLLPSMLSRLRDPGCPFADSICTALCNLSREEETCQSFLRSLTQEGMCQLLDMLCAPKYNPRASLDYLGPLLCNLTQLPEGRHFILDRNRCVVQRLLPYLQSGSTVRRGGIVGTLRNCCFSHRDHAWLLGDDVDLLPFLLLPLAGGEEFTEEEMETLPPDLQYLAEDKQREADPDIRKMLIETVLLLCATADGRRLVKQRGTYLVMRELHSWEREPCVKRACEKLIQMLIGEEPEAGLENLLEVTVPPDLEETLSRLDKEEEGPQGTLVQ
Donor tissue: tailbud