ORFeome > camk1 – XORFeome 2.0

camk1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis calcium/calmodulin-dependent protein kinase I, mRNA (cDNA clone MGC:69478 IMAGE:5336182), complete cds
Gene Symbol: camk1
Gene ID: 549023
ORF gb_acc: MG134256
ORF ID: 11918

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC090591

Library Location

Plate ID: GDExt11018
Well Location: C10

EST Sequences

Clone: MGC:69478 IMAGE:5336182
Trimmed Sequence: ATGCCCCTGGATGAAGATGGGCCGAGTTGGAAGAAAAGAGCAGAAGACATTAGAGATATCTATGAATTTCGGGAAGTCTTAGGAACGGGTGCTTTCTCTGAAGTGGTCCTGGCAGAGGAGAAGAAGACGCAGAAGTTGGTAGCCATTAAGTGTATTCCAAAGAAAGCCCTGGAGGGGAAAGAGACCAGCATAGAGAACGAGATTGCTGTGCTGAGAAAGATCAAGCACGCTAATATTGTGTCACTGGAGGACATCTATGAGAGCCGGAGTCACCTATACCTTATCATGCAGCTGGTGTCGGGGGGTGAGCTGTTTGACAGGATCGTGGAGAAAGGTTTCTATACAGAGAAGGATGCCAGCCAGCTCATCAAGCAGATTTTGGATGCTGTCAAGTACCTGCACGATATGGGCATTGTGCACAGGGATCTAAAGCCGGAGAATCTGCTCTATTACAGTATAGACGAAGATTCCAAAATTATGATCAGTGACTTTGGCCTCTCAAAAATCGAAGGGTCTGGAAGTGTAATGTCAACTGCCTGCGGCACTCCAGGTTATGTTGCTCCGGAGGTGTTGGCTCAGAAGCCTTACAGTAAAGCAGTGGATTGCTGGTCGATTGGTGTCATTGCATACATACTATTGTGCGGGTACCCACCATTCTACGATGAAAATGACGCCAAACTCTTTGAGCAGATTCTGAAAGCCGAGTATGAGTTTGACTCGCCGTACTGGGACGACATCTCCGATTCAGCCAAAGACTTCATCCAGCATCTAATGGAAAAGGATCCAAATAAGCGCAACACATGTGACCAAGCCCTGCAACATCCATGGATTGCTGGGGACACTGCACTGGATAAGAATATCCATGAATCAGTCAGCGAGCAAATCAGGAAAAATTTTGCCAAAAGCAGATGGAAGCAAGCATTCAATGCCACTGCTGTGGTACGCCACATGAGAAAGTTACAGCTGGGCACAAGCCAAGAAGGACCCGGTCAGACCACACCCACTAGCCCATGCCATGGCAATCTTCTTATGCCAGGGGATAACCATGGCTCTCATTCGGAGAGTTGTCAAGACTGCTGTTCTCCAAAATCCTCTGAAAACAACTCGTTGGCCTATAGCACCCAACACTGCGCACAATCCAACAGAGTTTAG
Full Trace Sequence: gaagaagtctaaccttgcgctctctccccagatctgaaccgctacttggactctcagggcgctgttaggaaagggacctcaggatgcccctggatgaagatgggccgagttggaagaaaagagcagaagacattagagatatctatgaatttcgggaagtcttaggaacgggtgctttctctgaagtggtcctggcagaggagaagaagacgcagaagttggtagccattaagtgtattccaaagaaagccctggaggggaaagagaccagcatagagaacgagattgctgtgctgagaaagatcaagcacgctaatattgtgtcactggaggacatctatgagagccggagtcacctataccttatcatgcagctggtgtcggggggtgagctgtttgacaggatcgtggagaaaggtttctatacagagaaggatgccagccagctcatcaagcagattttggatgctgtcaagtacctgcacgatatgggcattgtgcacagggatctaaagccggagaatctgctctattacagtatagacgaagattccaaaattatgatcagtgactttggcctctcaaaaatcgaagggtctggaagtgtaatgtcaactgcctgcggcactccaggttatgttgctccggaggtgttggctcagaagccttacagtaaagcagtggattgctggtcgattggtgtcattgcatacatactattgtgcgggtacccaccattctacgatgaaaatgacgccaaactctttgagcagattctgaaagccgagtatgagtttgactcgccgtactgggacgacatctccgattcagccaaagacttcatccagcatctaatggaaaaggatccaaataagcgcaacacatgtgaccaagccctgcaacatccatggattgctggggacactgcactggataagaatatccatgaatcagtcagcgagcaaatcaggaaaaattttgccaaaagcagatggaagcaagcattcaatgccactgctgtggtacgccacatgagaaagttacagctgggcacaagccaagaaggacccggtcagaccacacccactagcccatgccatggcaatcttcttatgccaggggataaccatggctctcattcggagagttgtcaagactgctgttctccaaaatcctctgaaaacaactcgttggcctatagcacccaacactgcgcacaatccaacagagtttagggcctgctgaagtggcttctggaacccagtgtcgttggaaagagcaggccccagtgctggatgtccaaccggactagatgcctgtgagcggcagaccttcaagcaaggacaggccaaccttattttaaaaatgtaaaaacatggggggagggcgaggggaaaagagaggaaacagagagagaagcaggcctctattatcttttgttattcttaataacagtacatctaattggataaaccaggcctggtgggaggagatgtttagagacagacaaaggcttgttgttattgttcatatgtaacatgttgcctgctcattgtatgacgtgtggggggagggttgtctaatatttttctgtattaaggtgaagatttgagttttaaggctcttgctgctgttttaattggctggttgccatgaactctaacggttatggttctggattctggtatagggagtgaacgcctgacattttggaaaggattccctgttgggctagacagacgtttttttaacagaaaagctttttagggaaacctcaaacactgagcaatttatgctattgtttttatagggggctaaggcaggctggggtgaaggacttctttttactgtgtaagtgacagcaggaattgttgaaatttgtacttgttcttccagtcctaaaaaaaaaaaatggttttagacacagtgcgtttcgcattgcattgtggaagccagagaaaggcaaacgggactaaatatcattccggacagctctttctcccagagctctgtatggcattgtgggtatttacacacttcaaacaaaattggttgtgtggtactggtggtgactgctaaaggaatttcctcattacaatcataatatgaatagtgatcgagtgatgcctacaagtattaaatgaccccacaatgtccatcttggaaatagttgatgtgctgatcctaactgaataccaggtgccgatatattaaagactttataatgcaaaatcaggtatgaggcgatatccttaattaaagaggtgattattcccagtttaggtgccaaatacccaagcaccatattgtagacgttgcagtgtgtgcgaggcagctattaataagccgattggctcactggaggcctatactagtgggcacttcttggcgctgagagggaacactcaggggtataacgtgatgcctccaggcctcccagcaggctccccctacttagaaaccatacagtttataatatgtggctcagaaaggtgaatttctgcttaaattctcatttttaattcatttttttatttaccttaaggtagtgttaagtcattaggataatgttgtaaaatgtgtgattttcctagtttcttatgtttttgagaagacccttatctactttcttgctgtcaaaataaaaaacacaaatccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MPLDEDGPSWKKRAEDIRDIYEFREVLGTGAFSEVVLAEEKKTQKLVAIKCIPKKALEGKETSIENEIAVLRKIKHANIVSLEDIYESRSHLYLIMQLVSGGELFDRIVEKGFYTEKDASQLIKQILDAVKYLHDMGIVHRDLKPENLLYYSIDEDSKIMISDFGLSKIEGSGSVMSTACGTPGYVAPEVLAQKPYSKAVDCWSIGVIAYILLCGYPPFYDENDAKLFEQILKAEYEFDSPYWDDISDSAKDFIQHLMEKDPNKRNTCDQALQHPWIAGDTALDKNIHESVSEQIRKNFAKSRWKQAFNATAVVRHMRKLQLGTSQEGPGQTTPTSPCHGNLLMPGDNHGSHSESCQDCCSPKSSENNSLAYSTQHCAQSNRV
Donor tissue: tailbud