ORFeome > cant1 – XORFeome 2.0

cant1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis calcium activated nucleotidase 1, mRNA (cDNA clone MGC:75940 IMAGE:5383867), complete cds
Gene Symbol: cant1
Gene ID: 394537
ORF gb_acc: MG133018
ORF ID: 10406

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061377

Library Location

Plate ID: GDExt11004
Well Location: B06

EST Sequences

Clone: MGC:75940 IMAGE:5383867
Trimmed Sequence: ATGAAATCTTCACATGTGGAATGTAAAGATTCTATGAGCCCACTGAGGATCAGTGTGGGTGGTCTTCCAGTTCTGGCTTCCATGACGAAGACAGCGGACCCCCGTTTCAGGCCACGCTGGGGTGCTATTCTTCTCTCGGGGGTCGGTGTTGCATTATTGCTGTTTCTTCTCTGTTACCATCGCTCCTCAGGGCCACGGACGGCAATCTCAAATGCCCACAACTGGAGGATGGGGCATCATGTGGCTGAGGGGCTCTATAATGACACTTACCCACTTACTCCTCCACTCAGAACTCCAGAGGGTCTTCGCTATCTTATTGCAATAATTGCCGATTTGGATACAGACTCTCGAAGTACCAAGGCTAATACTTGGATCAGCTATCTGAAAAGGGGTTATCTAACTCTGTCTAGTAGTGGAGATTTTGTGTCGGTCGAATGGGAGAAAGAGGACATTGTGTTGGAAACGCACCTTGCAGAAAAGGGACGCGGAATGGAGCTTTCAGAGCTGATTGTGTTTAATGGGAAGCTGTATTCTGTGGATGACCGCACAGGGGTGGTTTATAGAATTGAGGGAAGTAAAGCTATACCTTGGGTCATACTCCCAGATGGAGACGGGACTGTGGGCAAGGGGTTCAAGGCTGAGTGGCTGTCAGTTAAGGATGAGCAGCTGTATGTTGGTGGTTTGGGAAAGGAATGGACTACTACATCCGGGGTGGTGCTAAATGAAAATCCTGAATGGGTGAAAGTGATTGGACCACGGGGTGACATCCAGCATCACAACTGGGTTTCAAATTACAACTTGTTGCGATCAGCAGCTGGCATCGAACCACCAGGATACCTGATTCATGAATCTGCAGAATGGAGTGACTCTTTGCAGAGTTGGTTCTTCTTGCCCCGTCGTGCCAGTCAAGAACAATACAGTGAAAAGGAGGACGAGCAGCGCGGTTCCAACATTCTTCTTCGTGCTTCTCCTGACTTCTCAGACATCAAAATGTCCCACGTGGGAACACTGAATCCCACTCATGGCTTCTCCTCCTTTAAATTCATTCCAGGCACAGATGATCAGATCATTGTGGCTCTGAAATCAGAAGAGGATAATGGCAAAGTAGCCACATATATAACTGCATTTACATTGGATGGTAGAATTCTCTTACCCGAGACTAAAATAGGAACTGTTAAATATGAAGGAATTGAGTTCATCTGA
Full Trace Sequence: gtgtaagtagcgatccggaactgctgactgttgaaggaaaagcaggactgccgggcagtgtatatgcccaacatcatttgtgccacgttgttttattataagtgggtataaagtattaactcaagtatatctatctggctgtcatcgctcagaaggaagggtgcaaatccgtaattgagtctatatgaaatcttcacatgtggaatgtaaagattctatgagcccactgaggatcagtgtgggtggtcttccagttctggcttccatgacgaagacagcggacccccgtttcaggccacgctggggtgctattcttctctcgggggtcggtgttgcattattgctgtttcttctctgttaccatcgctcctcagggccacggacggcaatctcaaatgcccacaactggaggatggggcatcatgtggctgaggggctctataatgacacttacccacttactcctccactcagaactccagagggtcttcgctatcttattgcaataattgccgatttggatacagactctcgaagtaccaaggctaatacttggatcagctatctgaaaaggggttatctaactctgtctagtagtggagattttgtgtcggtcgaatgggagaaagaggacattgtgttggaaacgcaccttgcagaaaagggacgcggaatggagctttcagagctgattgtgtttaatgggaagctgtattctgtggatgaccgcacaggggtggtttatagaattgagggaagtaaagctataccttgggtcatactcccagatggagacgggactgtgggcaaggggttcaaggctgagtggctgtcagttaaggatgagcagctgtatgttggtggtttgggaaaggaatggactactacatccggggtggtgctaaatgaaaatcctgaatgggtgaaagtgattggaccacggggtgacatccagcatcacaactgggtttcaaattacaacttgttgcgatcagcagctggcatcgaaccaccaggatacctgattcatgaatctgcagaatggagtgactctttgcagagttggttcttcttgccccgtcgtgccagtcaagaacaatacagtgaaaaggaggacgagcagcgcggttccaacattcttcttcgtgcttctcctgacttctcagacatcaaaatgtcccacgtgggaacactgaatcccactcatggcttctcctcctttaaattcattccaggcacagatgatcagatcattgtggctctgaaatcagaagaggataatggcaaagtagccacatatataactgcatttacattggatggtagaattctcttacccgagactaaaataggaactgttaaatatgaaggaattgagttcatctgaaatctcatctaagatttaatcaatttaatcagacattgggatctccactaaagtcaattatcaaactccaattaaaaaaggaacacattatagtgaattgggcgatttattttctgacaatgatatgaatgaattcaagtggctatcatgtccttcgttatcaaaaggagcctcgtcgatttgtcagggtgcctgatatgcttttattaaacaatgttttttttattaacaaaaaaaaaaaaaaaaaaaaaaa
Translation: MKSSHVECKDSMSPLRISVGGLPVLASMTKTADPRFRPRWGAILLSGVGVALLLFLLCYHRSSGPRTAISNAHNWRMGHHVAEGLYNDTYPLTPPLRTPEGLRYLIAIIADLDTDSRSTKANTWISYLKRGYLTLSSSGDFVSVEWEKEDIVLETHLAEKGRGMELSELIVFNGKLYSVDDRTGVVYRIEGSKAIPWVILPDGDGTVGKGFKAEWLSVKDEQLYVGGLGKEWTTTSGVVLNENPEWVKVIGPRGDIQHHNWVSNYNLLRSAAGIEPPGYLIHESAEWSDSLQSWFFLPRRASQEQYSEKEDEQRGSNILLRASPDFSDIKMSHVGTLNPTHGFSSFKFIPGTDDQIIVALKSEEDNGKVATYITAFTLDGRILLPETKIGTVKYEGIEFI
Donor tissue: neurula