ORFeome > ccdc104 – XORFeome 2.0

ccdc104 – XORFeome 2.0

General Information

Species: Xenopus tropicalis Coiled-coil domain-containing protein 104, mRNA (cDNA clone MGC:76095 IMAGE:5308281), complete cds
Gene Symbol: ccdc104
Gene ID: 394695
ORF gb_acc: MG132762
ORF ID: 10066

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC062505

Library Location

Plate ID: GDExt11001
Well Location: B10

EST Sequences

Clone: MGC:76095 IMAGE:5308281
Trimmed Sequence: ATGGCCTCGGATACGGAATGGGTGCTGGAGAGTGTCCTGGGCTTCGTGAGTGGGCCCGTCTGGACGGTGCCAGTGTTGGAATTCATGGAGCAGAAGTGCTCAGTTTTTGATGATGAAGAGGAAAACAAGTTATCCTACACAGAGATTCACAATGAGTACAAAGAACTGGTAGAAACTCTTCTAACGCAACATCTAAATGAAGTGGGGATTAGTGAGGAGCAATTTCAAGAAGCCTGCACAGCTCCCCTTGCACATTCTGCAACACTTAAGACTATTTTGCAGCCTGTTCTGGCTGTGGAAGATTTTAAGATCTTTAAAGCGATGATGGTGCAGAAAAACATTGAACTACAACTACAAGCAATTCGAATAATACAAGAAAGAAATGGTGTGCTCCCGGATTGTTTGCAGCATGGCAGAGATATTATTTCTGACCTTGAACAACAAGAGATGAAACTGGTATCAGAAGCACTCAGGTTATCAAAGGAAGAGTATGAGCGGGAGCAGCTACGGAGGAGTGCAAAGGAATTGAATCTCACTCTTGGGGAACATTCTGAAAACAAACAGTCGAGTGGCAGTGAGAGAACACCAAACAATACTGAACTTCCGGTTAAGACTCAAAAAGAAGAAAAGCAGCCAGTGAATATGCTGGAAAGTCCTTATAAAGAAGTTTCCATAAAATTAAAAGAAATGAGCAACACAGAAGCAGCAGAGGCCTGGCTGGAGCAAGCAAGGAAAGAGGCCGGTATCCTCAGTTCAGTTACAAACTTATCACAAGCAGAAAAGGAACAGCTTCAGAAAAGAGCAGAATATCTCAGAAGGCGAAGGGAAGAGCTGCTGGCGAAGAAACAGGAATCAAAGAAAATGGCACAGAATTCGGAAGAACATGAAGAAAAAGCAACATGCTCGAAACAGGAAATGACAGAAGAAGAAAAGAAAAGTTTGCAAAGAAGAAAACGGCTAGCGGAAAAGCTGAAGGAGGAAGTGATTTTATCATGTGAAAAGTCTGGCTCCGCCTCTTGA
Full Trace Sequence: ctcatacaccgcgcctgctctagccttacatattctccctcagcgccgcagctttgtgagggggcggccatggcctcggatacggaatgggtgctggagagtgtcctgggcttcgtgagtgggcccgtctggacggtgccagtgttggaattcatggagcagaagtgctcagtttttgatgatgaagaggaaaacaagttatcctacacagagattcacaatgagtacaaagaactggtagaaactcttctaacgcaacatctaaatgaagtggggattagtgaggagcaatttcaagaagcctgcacagctccccttgcacattctgcaacacttaagactattttgcagcctgttctggctgtggaagattttaagatctttaaagcgatgatggtgcagaaaaacattgaactacaactacaagcaattcgaataatacaagaaagaaatggtgtgctcccggattgtttgcagcatggcagagatattatttctgaccttgaacaacaagagatgaaactggtatcagaagcactcaggttatcaaaggaagagtatgagcgggagcagctacggaggagtgcaaaggaattgaatctcactcttggggaacattctgaaaacaaacagtcgagtggcagtgagagaacaccaaacaatactgaacttccggttaagactcaaaaagaagaaaagcagccagtgaatatgctggaaagtccttataaagaagtttccataaaattaaaagaaatgagcaacacagaagcagcagaggcctggctggagcaagcaaggaaagaggccggtatcctcagttcagttacaaacttatcacaagcagaaaaggaacagcttcagaaaagagcagaatatctcagaaggcgaagggaagagctgctggcgaagaaacaggaatcaaagaaaatggcacagaattcggaagaacatgaagaaaaagcaacatgctcgaaacaggaaatgacagaagaagaaaagaaaagtttgcaaagaagaaaacggctagcggaaaagctgaaggaggaagtgattttatcatgtgaaaagtctggctccgcctcttgagtctcctaaatgattgaccccattgccaaagctactcgtatatttttgtatgccttaaatacatatttagagctgcttgggttggaagaggttaatatcaccaaatggttgcctgggacagatgcatgttttgtacatacactagagcaagggtccccaaatttattttaccggagagccacattcagatataaaaagagttggggagcaacacatacacgaaaaaagttcttggggtgctaataaaaaaaaaaaaaaaaaaaaaa
Translation: MASDTEWVLESVLGFVSGPVWTVPVLEFMEQKCSVFDDEEENKLSYTEIHNEYKELVETLLTQHLNEVGISEEQFQEACTAPLAHSATLKTILQPVLAVEDFKIFKAMMVQKNIELQLQAIRIIQERNGVLPDCLQHGRDIISDLEQQEMKLVSEALRLSKEEYEREQLRRSAKELNLTLGEHSENKQSSGSERTPNNTELPVKTQKEEKQPVNMLESPYKEVSIKLKEMSNTEAAEAWLEQARKEAGILSSVTNLSQAEKEQLQKRAEYLRRRREELLAKKQESKKMAQNSEEHEEKATCSKQEMTEEEKKSLQRRKRLAEKLKEEVILSCEKSGSAS
Donor tissue: gastrula