ORFeome > ccnf – XORFeome 2.0

ccnf – XORFeome 2.0

General Information

Species: Xenopus tropicalis cyclin F, mRNA (cDNA clone MGC:89348 IMAGE:6987891), complete cds
Gene Symbol: ccnf
Gene ID: 496496
ORF gb_acc: MG134353
ORF ID: 12040

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC084474

Library Location

Plate ID: GDExt11019
Well Location: C12

EST Sequences

Clone: MGC:89348 IMAGE:6987891
Trimmed Sequence: ATGAAGGGAGGAGCCTTGCACTGCCGCTGCTCCAAATGCTTTGCTGCTCCTCCGAAGCGGCGAGTAAAGAGGCGACCCCGCGTGCTGACCTTGCTCAGTCTGCCGGAAGATGTTCTTCTCTATGTGCTGGAATGCCTGCCTGCTGTGGACATCCTATCCATGCGAGAGGTTCATCCACATTTGAGGTCCCTGGTGGATTCTCACAGTAGTGTTTGGGCTCGTGCCTCTTTCCAAGATGTCTGGCCTTCTCCTGAAAACTTGAATCTCTTTGAAAGGGCAGCTGAATGCGGTAACTTCGAAGCGTGTGTGAAGCTAGGGATCGCTTACTTGTACAATGAAGGCTTGTCCTTGTCAGACGATGGGAGGGCAGAAGTGAACGGACTGAAGGCCTCTCGTTTCTTCAGCCTGACTGAACGCCTGAATTCTGGTGCAGATCCCTTTGTGTGGCTTTTCATCCGCCCCCCTTGGTCCTCGTCTGGAAGCTGCTGTAAGGCGGTGGTGTTTGACAGCCTGAAAGAGGAGTGTGGGACTGTTACAAGTGAAGAAGGGGCAACGGGGGCTCTCAAAGGATCAATTCAGTATTGTCTGGCAAAAGTTCTGAGCCTGTTTGAGGATGATGACAAGAAGAGAGAAGCTCTGGGAATGCTTGAATCGTCTGCCTCCCATGGCTGTTTGCATAGCTCTTACTTACTCTGGGAAACCAAACAGAAAACTGCTTTATCAGACCCTGGCAGATACCTACAGAGCTTTAGGCAGCTACGAGATTATGCGGCAAGGGGTTGCTGGGATGCACAGATTTCCTTGGCGAAGGCTTGTGGTCACAAGAACCAGCTGAGCCAGGAGCAGCGATCAGCTAGTGAATTGGTAAACCAAGTATTCCAGTCATCTCTGCCTATCAACAAAACCAGCATCTTTACCACTCAGAAGGGCATGAATGACACTATGCGGTACATCTTAATAGACTGGCTGGTAGAGGTTGCCACTATGAAAGATTTCTCCAGTCTTTGTTTACACATGACAGTGGGTCTGGTGGACCGGTACTTAAAACTGCGCAGCGTCCCACGGGCCAAGCTCCAACTGGTGGGAATTGCCTGCATGGTCATATGCACACGCTTTATTAGCAAAGAGATCCTGACAATCCGAGAAGCAGTGTGGCTGACTGATAACACCTATAAGTATGAGGATCTGGTTCGGATGATGGGAGAAATCATATCTGCACTGGAGGGCAAAATAAGGATGCCCACCGTGGTAGACTATAAAGATGTCCTGTCTCACCTCATCCCTCTGGACAGGAGCACTCTGCATCTATGCAGCTATATTTCAGAGCTTTCCCTACTGTACACAGAGCTGTCCACGTATTCACCGGCTCAACTAGCTGCTGGCGCACTGCTGCTGGCCAGGATACTGCACAAGCAAGCACGTCCGTGGCCTGCCCAGCTTGCAGAGACGACGGGCTTCACACTGGAACACCTTACTCCATGTGTTGTACTTCTGCACAAGAAATGTTTCCACGATGATGCGCCCAAAGATTACCGGCAAGTGTCCCTGACCGCTGTGAAACAGCGCTTCCAGGATGATCTTTATGATCAGATCAGTAAAGAGAAGGTGATGGATCACAGTCATCTGTGTGAGCTGCTTGGAGTCCCGTGCCGTGATTCAGAGTCTCCCGCATCTTGTCCTAACGCCGCTGACTTCCATCAGTTCCTGTGCTCTCCTTCTGGGAGCAAAACAAAGAGGCGCAGGGAGGACAGCATACAAGAGGACAGGGGAAGCTTTGTCACCACTCCCACTGCTGAACTCTCCAATCAGGAGGAGGATCTGCTTGGAGACTTCCTAGACTGGAGCCTTGAAACCTCTTGTTCTGGTTATGAAGGGGATCGGGAAAGTGAAGGCGAGCGGGAAGGAGAAGTAACCGCACCCAGTGGAGTCCTGGATCTTTCACTCCTGATTACTGAACACCAGCAATGCCAGGATACCACCAGTGATGACGACTCTCTCGTCCCACTCCACCCAATCCCATTGCTGTCCAAGTTAGAAAATGGAACCCACTCCACAGAAGGGTGTGCAGAGAAAAGCTCTGGTTATTCTTCAGTAAGCAGTGGGGGCAGCCCGACATCATCTTCCTCTCCTCCAGGCCTCCCGTTCACCCCAACCCCAGGACTAAACCACAGCAAACTGATGCCTATTCCCTTTCCCCAGCCATGCTCACCTTTGTTCAAGGCAAGCCGCAGGCAGGTAAAGAGGAAAAACCAAGCGCAGCACAGTGAAGATAACCTCTCTGATGAACTGTAA
Full Trace Sequence: ctgagccaggcggtagcaccgattcccactgctcatctacctcaccagctaattgctcggcatgaagggaggagccttgcactgccgctgctccaaatgctttgctgctcctccgaagcggcgagtaaagaggcgaccccgcgtgctgaccttgctcagtctgccggaagatgttcttctctatgtgctggaatgcctgcctgctgtggacatcctatccatgcgagaggttcatccacatttgaggtccctggtggattctcacagtagtgtttgggctcgtgcctctttccaagatgtctggccttctcctgaaaacttgaatctctttgaaagggcagctgaatgcggtaacttcgaagcgtgtgtgaagctagggatcgcttacttgtacaatgaaggcttgtccttgtcagacgatgggagggcagaagtgaacggactgaaggcctctcgtttcttcagcctgactgaacgcctgaattctggtgcagatccctttgtgtggcttttcatccgccccccttggtcctcgtctggaagctgctgtaaggcggtggtgtttgacagcctgaaagaggagtgtgggactgttacaagtgaagaaggggcaacgggggctctcaaaggatcaattcagtattgtctggcaaaagttctgagcctgtttgaggatgatgacaagaagagagaagctctgggaatgcttgaatcgtctgcctcccatggctgtttgcatagctcttacttactctgggaaaccaaacagaaaactgctttatcagaccctggcagatacctacagagctttaggcagctacgagattatgcggcaaggggttgctgggatgcacagatttccttggcgaaggcttgtggtcacaagaaccagctgagccaggagcagcgatcagctagtgaattggtaaaccaagtattccagtcatctctgcctatcaacaaaaccagcatctttaccactcagaagggcatgaatgacactatgcggtacatcttaatagactggctggtagaggttgccactatgaaagatttctccagtctttgtttacacatgacagtgggtctggtggaccggtacttaaaactgcgcagcgtcccacgggccaagctccaactggtgggaattgcctgcatggtcatatgcacacgctttattagcaaagagatcctgacaatccgagaagcagtgtggctgactgataacacctataagtatgaggatctggttcggatgatgggagaaatcatatctgcactggagggcaaaataaggatgcccaccgtggtagactataaagatgtcctgtctcacctcatccctctggacaggagcactctgcatctatgcagctatatttcagagctttccctactgtacacagagctgtccacgtattcaccggctcaactagctgctggcgcactgctgctggccaggatactgcacaagcaagcacgtccgtggcctgcccagcttgcagagacgacgggcttcacactggaacaccttactccatgtgttgtacttctgcacaagaaatgtttccacgatgatgcgcccaaagattaccggcaagtgtccctgaccgctgtgaaacagcgcttccaggatgatctttatgatcagatcagtaaagagaaggtgatggatcacagtcatctgtgtgagctgcttggagtcccgtgccgtgattcagagtctcccgcatcttgtcctaacgccgctgacttccatcagttcctgtgctctccttctgggagcaaaacaaagaggcgcagggaggacagcatacaagaggacaggggaagctttgtcaccactcccactgctgaactctccaatcaggaggaggatctgcttggagacttcctagactggagccttgaaacctcttgttctggttatgaaggggatcgggaaagtgaaggcgagcgggaaggagaagtaaccgcacccagtggagtcctggatctttcactcctgattactgaacaccagcaatgccaggataccaccagtgatgacgactctctcgtcccactccacccaatcccattgctgtccaagttagaaaatggaacccactccacagaagggtgtgcagagaaaagctctggttattcttcagtaagcagtgggggcagcccgacatcatcttcctctcctccaggcctcccgttcaccccaaccccaggactaaaccacagcaaactgatgcctattccctttccccagccatgctcacctttgttcaaggcaagccgcaggcaggtaaagaggaaaaaccaagcgcagcacagtgaagataacctctctgatgaactgtaaagaactcaacccttccaaattttgtacagagatatatgtatagatatatatatttggcattaaaagagaaaattctgtaaaaaaaaaaaaaaaaaa
Translation: MKGGALHCRCSKCFAAPPKRRVKRRPRVLTLLSLPEDVLLYVLECLPAVDILSMREVHPHLRSLVDSHSSVWARASFQDVWPSPENLNLFERAAECGNFEACVKLGIAYLYNEGLSLSDDGRAEVNGLKASRFFSLTERLNSGADPFVWLFIRPPWSSSGSCCKAVVFDSLKEECGTVTSEEGATGALKGSIQYCLAKVLSLFEDDDKKREALGMLESSASHGCLHSSYLLWETKQKTALSDPGRYLQSFRQLRDYAARGCWDAQISLAKACGHKNQLSQEQRSASELVNQVFQSSLPINKTSIFTTQKGMNDTMRYILIDWLVEVATMKDFSSLCLHMTVGLVDRYLKLRSVPRAKLQLVGIACMVICTRFISKEILTIREAVWLTDNTYKYEDLVRMMGEIISALEGKIRMPTVVDYKDVLSHLIPLDRSTLHLCSYISELSLLYTELSTYSPAQLAAGALLLARILHKQARPWPAQLAETTGFTLEHLTPCVVLLHKKCFHDDAPKDYRQVSLTAVKQRFQDDLYDQISKEKVMDHSHLCELLGVPCRDSESPASCPNAADFHQFLCSPSGSKTKRRREDSIQEDRGSFVTTPTAELSNQEEDLLGDFLDWSLETSCSGYEGDRESEGEREGEVTAPSGVLDLSLLITEHQQCQDTTSDDDSLVPLHPIPLLSKLENGTHSTEGCAEKSSGYSSVSSGGSPTSSSSPPGLPFTPTPGLNHSKLMPIPFPQPCSPLFKASRRQVKRKNQAQHSEDNLSDEL
Donor tissue: gastrula