ORFeome > cct4 – XORFeome 2.0

cct4 – XORFeome 2.0

General Information

Species: Xenopus tropicalis chaperonin containing TCP1, subunit 4 (delta), mRNA (cDNA clone MGC:89275 IMAGE:6977162), complete cds
Gene Symbol: cct4
Gene ID: 448604
ORF gb_acc: MG133795
ORF ID: 11367

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076940

Library Location

Plate ID: GDExt11013
Well Location: E05

EST Sequences

Clone: MGC:89275 IMAGE:6977162
Trimmed Sequence: ATGCCGGATAATTCTGCGCCCAAAGTTGTAGCCTCCGCCGGAGGGGCAGGGAACGGCGCCGGGAAAAAGAAGGGTGCCTACCAGGACAGGGACAAGCCGGCTCAGATTCGCTTTAGCAACATCTCTGCGGGGAAAGCTGTTGCTGATGCTGTCAGAACCAGTCTGGGACCAAAGGGCATGGATAAAATGATTCAGGATGGAAAAGGAGATGTGACCATTACAAATGATGGTGCAACTATTTTGAAACTGATGCAGGTTTTGCACCCAGCAGCCAAAATGCTTGTTGAGTTATCTAAAGCCCAAGACATTGAGGCTGGAGATGGAACAACCTCAGTTGTAGTTATTGCTGGAGCCCTGCTTGATGCTTGTGCCAAGCTTCTACAGAAAGGTATACATCCCACCACCATTTCAGAATCCTTCCAGTTGGCATCCGATAAGGGTATAGAAGTTCTTACCAACATGTCCCAGTCTGTTGAATTAAGTGACAGAGAAACTCTACTTAACAGTGCAACAACATCCCTGAACTCAAAGGTTGTGTCCCAGTACTCAAGTTTACTTGCTCCAATGAGTGTGGATGCAGTAATGAAGGTGATTGATCCACAGACAGCCAACAGTGTGGATCTTAGAGATATAAAAATTGTCAAAAAACTTGGAGGAACCATTGATGATTGTGAGATGGTTGATGGCCTTGTGCTCACACAGAAAGCGGCAAATACTGGAGTAACCCGGGTTGAGAAAGCCAAGATTGGGCTGATTCAGTTCTGCTTGTCAGCTCCAAAAACAGATATGGACAATCAGATTGTGGTTTCAGACTATGCTCAGATGGATAGAGTTCTGCGGGAGGAACGAACATACATCCTTAATCTTGTGAAACAAATCAAGAAAGCTGGTTGCAATGTGCTTCTTATTCAGAAATCAATTTTAAGGGATGCTCTTAGTGATCTTGCTTTACACTTCCTGAATAAGATGAAAATAATGGTGGTGAAAGATATTGAGAGAGAAGATATTGAGTTTATATGTAAGACAATTGGAACTAAACCAGTTGCACACATAGACCAGTTTACTGCTGATATGCTGGCATCGGCTGAACTTGCTGAAGAAGTTAGTCTGAACGGTTCTGGAAAACTAGTTAAGATAACTGGTTGTGCCAACCCCGGGAAAACTGTTACAATTGTTGTACGTGGTTCCAACAAACTGGTGATTGAGGAAGCAGAACGCTCCATTCATGATGCCCTTTGTGTTATACGCTGCTTGGTAAAGAAAAGAGCTCTGATTGCTGGAGGCGGTGCCCCTGAGATTGAGCTATCCCTGCGTTTGAATGAGTATGCTAGGACACTGAGTGGCATGGAGTCCTACTGTATTCGAGCCTTTGCAGATGCCTTGGAGATTATTCCTTTCACTCTGGCTGAAAATGCTGGACTCAACCCCATATCCACTGTAACGGAACTGAGAAACAGACACGCACAGGGCGAAAAAACAGCCGGAATTAATGTCAGAAAGGGGGGAATTTCCAATATTTTGGAGGAACTTGTTGTCCAGCCCTTGTTGGTATCTATCAGCTCTCTAACTCTGGCTACAGAGACTGTGCGCAGTATTCTCAAGATTGATGATGTGGTGAACACACGATAA
Full Trace Sequence: ccgcatactatccgctgccatcctcccttgtgcccggcccgcttccatcggggcatcacctccacacatcaggtggcaccgccagagccaaagcagtcacgatgccggataattctgcgcccaaagttgtagcctccgccggaggggcagggaacggcgccgggaaaaagaagggtgcctaccaggacagggacaagccggctcagattcgctttagcaacatctctgcggggaaagctgttgctgatgctgtcagaaccagtctgggaccaaagggcatggataaaatgattcaggatggaaaaggagatgtgaccattacaaatgatggtgcaactattttgaaactgatgcaggttttgcacccagcagccaaaatgcttgttgagttatctaaagcccaagacattgaggctggagatggaacaacctcagttgtagttattgctggagccctgcttgatgcttgtgccaagcttctacagaaaggtatacatcccaccaccatttcagaatccttccagttggcatccgataagggtatagaagttcttaccaacatgtcccagtctgttgaattaagtgacagagaaactctacttaacagtgcaacaacatccctgaactcaaaggttgtgtcccagtactcaagtttacttgctccaatgagtgtggatgcagtaatgaaggtgattgatccacagacagccaacagtgtggatcttagagatataaaaattgtcaaaaaacttggaggaaccattgatgattgtgagatggttgatggccttgtgctcacacagaaagcggcaaatactggagtaacccgggttgagaaagccaagattgggctgattcagttctgcttgtcagctccaaaaacagatatggacaatcagattgtggtttcagactatgctcagatggatagagttctgcgggaggaacgaacatacatccttaatcttgtgaaacaaatcaagaaagctggttgcaatgtgcttcttattcagaaatcaattttaagggatgctcttagtgatcttgctttacacttcctgaataagatgaaaataatggtggtgaaagatattgagagagaagatattgagtttatatgtaagacaattggaactaaaccagttgcacacatagaccagtttactgctgatatgctggcatcggctgaacttgctgaagaagttagtctgaacggttctggaaaactagttaagataactggttgtgccaaccccgggaaaactgttacaattgttgtacgtggttccaacaaactggtgattgaggaagcagaacgctccattcatgatgccctttgtgttatacgctgcttggtaaagaaaagagctctgattgctggaggcggtgcccctgagattgagctatccctgcgtttgaatgagtatgctaggacactgagtggcatggagtcctactgtattcgagcctttgcagatgccttggagattattcctttcactctggctgaaaatgctggactcaaccccatatccactgtaacggaactgagaaacagacacgcacagggcgaaaaaacagccggaattaatgtcagaaaggggggaatttccaatattttggaggaacttgttgtccagcccttgttggtatctatcagctctctaactctggctacagagactgtgcgcagtattctcaagattgatgatgtggtgaacacacgataaacttatatgccatttagcggatgggtctgaaaaagtgacccaagcaaccaccgtggagatcaaagctggctactaacacgcgttgttcaactacttgtcggcacttaatttaataaaattcttacataatgactctaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MPDNSAPKVVASAGGAGNGAGKKKGAYQDRDKPAQIRFSNISAGKAVADAVRTSLGPKGMDKMIQDGKGDVTITNDGATILKLMQVLHPAAKMLVELSKAQDIEAGDGTTSVVVIAGALLDACAKLLQKGIHPTTISESFQLASDKGIEVLTNMSQSVELSDRETLLNSATTSLNSKVVSQYSSLLAPMSVDAVMKVIDPQTANSVDLRDIKIVKKLGGTIDDCEMVDGLVLTQKAANTGVTRVEKAKIGLIQFCLSAPKTDMDNQIVVSDYAQMDRVLREERTYILNLVKQIKKAGCNVLLIQKSILRDALSDLALHFLNKMKIMVVKDIEREDIEFICKTIGTKPVAHIDQFTADMLASAELAEEVSLNGSGKLVKITGCANPGKTVTIVVRGSNKLVIEEAERSIHDALCVIRCLVKKRALIAGGGAPEIELSLRLNEYARTLSGMESYCIRAFADALEIIPFTLAENAGLNPISTVTELRNRHAQGEKTAGINVRKGGISNILEELVVQPLLVSISSLTLATETVRSILKIDDVVNTR
Donor tissue: tailbud