ORFeome > cdc6 – XORFeome 2.0

cdc6 – XORFeome 2.0

General Information

Species: Xenopus tropicalis cdc6 protein, mRNA (cDNA clone MGC:79457 IMAGE:5308239), complete cds
Gene Symbol: cdc6
Gene ID: 493356
ORF gb_acc: MG133579
ORF ID: 11115

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080872

Library Location

Plate ID: GDExt11010
Well Location: D07

EST Sequences

Clone: MGC:79457 IMAGE:5308239
Trimmed Sequence: ATGCCAAGCACCAGGTCTCAGTCTCAAAGCGCCATTCAGTTTCCCAAGAAAAAAAATGCTCGAACGCACACCAAAGAGGCCTCCCGTGAAAGGACCAAATTGGAAAACGGCTCCTCTGTCGCGCTGCCACTCTCTCCACTTCCCAAAGAGCTTCCCCTGAGTCCAAGGAAACGACTTGGTGATGACAATCTTTGCAATGTTCCCCAGACATTAAGCTGCTCACCACCCAAGCAGTCTCGCAAAGAGAATGGCCCGCCAAGCACCCCTAAGGGACGCCGGTTACTTTTTGACGAGAACCAGTCGGCAACAACACCTGTATCTCCTCTCAAGAGGGTGCAGGATCCTTATTTGCTGTCCCCTTTGAGAAGGGGGCAAGAGACACCATCCAGCTCTCGCAACAACGAGAGGAAGAGTGTGGGTGCCCGGCTATTTAAACAGGAGGGTTCTTGCTATCAGAAGGCTAAGCATGCTTTGAATACAGCTATACCAGAGCGTCTATTGGCCCGTGACAGTGAGACTGCGACTATCAAGGCCTTCCTGACAAGTCATGTCTCTGGTGGGAAGCCAGGAAGCCTTTACATATCTGGTGCTCCAGGAACTGGCAAAACGGCTTGCTTGAATAAGCTGCTGCAGGAGAGCAAGGATGACCTCAAGCAATGCAAGACGGTTTACATCAACTGCATGTCATTGCGCAGCTCCCAGGCGGTGTTTCCGGCCATAGCTGAAGAAATCTCTGGTGGAAAATCTTCAATTGCTGCAAAAGATATTGTTAGGAGTTTGGAGAAGACGGTGACTTCAAAGGGCCCAATCATCCTGCTGGTGCTGGATGAGATGGATCAGCTCGATAGTCGAGGACAGGATGTCTTATACACAGTGTTTGAGTGGCCCTGGCTTCCAAATTCTAGGGTGGTTCTTATTGGCATTGCTAACGCGTTAGATTTGACAGACCGTATTCTGCCTAGGCTACAAGCTCGACCTCAGTGCAAGCCACAGCTGCTTAACTTCTCTCCGTATACAAAGGATCAGATTGCTACCATTCTGCAGGAGAGACTAAATCAGGTTTCAGGTGACCAGGTTCTGGATAATGCTGCTATTCAGTTTTGTGCCAGGAAAATTTCAGCAGTCTCTGGAGATGCTCGAAAGGCACTAGACATCTGCAGGAGAGCTGTTGAAATTGTTGAAGCGGATGTAAGGGGCCAGACTGTCCTCAAGCCGCTAACTGAAAGTCTCTCTCCTAGTAAGGAAGTTCCATCAAACCCTGTTCCAAAAAAAGTCAGCCTTCCACACATCTCCCGTGTCCTGTCAGATGTATATGGGGACAAGATGGCAAGCAGTGGGGGGTCAAGCGAGAGCTTTCCCTTACAACAGAAACTGCTGGTCTGTGCCCTGCTGCTGCTAACTCGACAGAGCAAGATCAAGGAAGTCACACTTGGCAAGTTGCACGAGGCATACAGTAAAGTCTGCCGAAAGCAGCAGGTTCCCGGCGTTGGGCAATCGGAGTGCCTGTCACTTTGTCAGCTCCTGGAGACAAGGGGCATTCTGGGGCTAAAGAAAGCCAAGGAGGCCCGGCTTACAAAGGTATCCCTCAAGATAGAGGAGCGGGATATTGAACATGCATTCAAAGATAAAGTTCTGATTGGAAATGTTCTGAATTCGGGGATATAA
Full Trace Sequence: ctcggagaggaagcggtgagagctgcgagttgttacttccaactgaattcagtcacactatcgctgagaagccgcaatgccaagcaccaggtctcagtctcaaagcgccattcagtttcccaagaaaaaaaatgctcgaacgcacaccaaagaggcctcccgtgaaaggaccaaattggaaaacggctcctctgtcgcgctgccactctctccacttcccaaagagcttcccctgagtccaaggaaacgacttggtgatgacaatctttgcaatgttccccagacattaagctgctcaccacccaagcagtctcgcaaagagaatggcccgccaagcacccctaagggacgccggttactttttgacgagaaccagtcggcaacaacacctgtatctcctctcaagagggtgcaggatccttatttgctgtcccctttgagaagggggcaagagacaccatccagctctcgcaacaacgagaggaagagtgtgggtgcccggctatttaaacaggagggttcttgctatcagaaggctaagcatgctttgaatacagctataccagagcgtctattggcccgtgacagtgagactgcgactatcaaggccttcctgacaagtcatgtctctggtgggaagccaggaagcctttacatatctggtgctccaggaactggcaaaacggcttgcttgaataagctgctgcaggagagcaaggatgacctcaagcaatgcaagacggtttacatcaactgcatgtcattgcgcagctcccaggcggtgtttccggccatagctgaagaaatctctggtggaaaatcttcaattgctgcaaaagatattgttaggagtttggagaagacggtgacttcaaagggcccaatcatcctgctggtgctggatgagatggatcagctcgatagtcgaggacaggatgtcttatacacagtgtttgagtggccctggcttccaaattctagggtggttcttattggcattgctaacgcgttagatttgacagaccgtattctgcctaggctacaagctcgacctcagtgcaagccacagctgcttaacttctctccgtatacaaaggatcagattgctaccattctgcaggagagactaaatcaggtttcaggtgaccaggttctggataatgctgctattcagttttgtgccaggaaaatttcagcagtctctggagatgctcgaaaggcactagacatctgcaggagagctgttgaaattgttgaagcggatgtaaggggccagactgtcctcaagccgctaactgaaagtctctctcctagtaaggaagttccatcaaaccctgttccaaaaaaagtcagccttccacacatctcccgtgtcctgtcagatgtatatggggacaagatggcaagcagtggggggtcaagcgagagctttcccttacaacagaaactgctggtctgtgccctgctgctgctaactcgacagagcaagatcaaggaagtcacacttggcaagttgcacgaggcatacagtaaagtctgccgaaagcagcaggttcccggcgttgggcaatcggagtgcctgtcactttgtcagctcctggagacaaggggcattctggggctaaagaaagccaaggaggcccggcttacaaaggtatccctcaagatagaggagcgggatattgaacatgcattcaaagataaagttctgattggaaatgttctgaattcggggatataatgttttgttctgcgtgtatctctgatgtaacttctgtaaatttatgtacaattttagctaatgtatctttagaattttatcagttttattttttggacacgtgactgtttacacttgtgtgggtactttttttatttataaagtgaaaaaaattgcaggcccctttttaaagaacaggcacttggttttatcctatgcctggttgtcttccatttttcagcacagtcataagtatggaggctttaagtgtctacacatgaaataaactctagtgtctgttgtaaatagttggcgctgagggcgctgtttataatttgctgtcatagacagcaatgttaatgtttaagtatctgtaaggtacggtcctgtttgtggtggtctctcgtggacatggtgtctttatgacctggattatacttgcgttttaatcaagactcctattttaataaacgtttaaaacattaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MPSTRSQSQSAIQFPKKKNARTHTKEASRERTKLENGSSVALPLSPLPKELPLSPRKRLGDDNLCNVPQTLSCSPPKQSRKENGPPSTPKGRRLLFDENQSATTPVSPLKRVQDPYLLSPLRRGQETPSSSRNNERKSVGARLFKQEGSCYQKAKHALNTAIPERLLARDSETATIKAFLTSHVSGGKPGSLYISGAPGTGKTACLNKLLQESKDDLKQCKTVYINCMSLRSSQAVFPAIAEEISGGKSSIAAKDIVRSLEKTVTSKGPIILLVLDEMDQLDSRGQDVLYTVFEWPWLPNSRVVLIGIANALDLTDRILPRLQARPQCKPQLLNFSPYTKDQIATILQERLNQVSGDQVLDNAAIQFCARKISAVSGDARKALDICRRAVEIVEADVRGQTVLKPLTESLSPSKEVPSNPVPKKVSLPHISRVLSDVYGDKMASSGGSSESFPLQQKLLVCALLLLTRQSKIKEVTLGKLHEAYSKVCRKQQVPGVGQSECLSLCQLLETRGILGLKKAKEARLTKVSLKIEERDIEHAFKDKVLIGNVLNSGI
Donor tissue: gastrula