ORFeome > cecr5 – XORFeome 2.0

cecr5 – XORFeome 2.0

General Information

Species: Xenopus tropicalis cat eye syndrome chromosome region, candidate 5 homolog (human), mRNA (cDNA clone MGC:89407 IMAGE:6989826), complete cds
Gene Symbol: cecr5
Gene ID: 496502
ORF gb_acc: MG134344
ORF ID: 12028

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC084481

Library Location

Plate ID: GDExt11019
Well Location: B12

EST Sequences

Clone: MGC:89407 IMAGE:6989826
Trimmed Sequence: ATGAGTCGCTGGCTGAGGCCGGTGCTGTCCCGGGTGGTGAGTCGGGTCGGGCTGAGCGGAGCGGCCCGGGAGCCTCAGGCCGAGGCTCAGGCCAAGTTTGGGCTCCTGTTCGACATCGATGGGGTCCTGGTGCGAGGCAAGACCCCCATACCCGCCGCCAGGAAGGCCTTCCACAAGCTGGTGGATTCCCAGGGGCAGTTCCTGGTTCCCGTGGTGTTTGTAACCAACGCCGGAAACTGCCTGCGCCAGACCAAAGCCGACCAGCTCTCCCATATCCTCGGGGTCCCCATCTGCCAGGACCAAGTGCTGATGTCCCACAGTCCCCTGAGGATATTTAAGCAGTACCATAACAAGTGCGTTCTGGTATCGGGACAGGGCCCCCTGCTGGACATCGCCAAATATTTAGGATTCTCGAATCCTATCACAATTGACTCTCTGAGGGAGTCGTACCCCTTTCTGGACATGGTGGACCACACGAGGCGCCCCAAAATCCTGCCTTCCTCAGCCACAGATCTGCCCAGGATAGAGGCTGTCGTTCTGTTCGGGGAACCAATCCGGTGGGAGACAAACCTGCAGCTCATCGTTGATGTCCTACTGACTGGCGGTTACCCTGTCAACCACCACCAACCTGCCAGTTACCCCCATATCCCCGTGCTGGGCTGTAACATGGATCTGATGTGGATGGCCGAGGCCCACTCGCCAAGGTTTGGCCACGGGACCTTCATGGTTTGCCTGGAGAACATCTACAAGAAGATCACGGGGAAGGAGCTGAAGTACGAGGCGCTGATGGGCAAACCCAGTGAGGTGACGTTCCAGTACGCGGAGTATCTGATCCGGACGCAGGCGGCGCAGAGACAGTGGGCCGAGCCAATCAGAACGCTCTATGCAATCGGGGACAATCTGATGACGGATATCTATGGCGCTAACCTGTACAACCGCTACCTGCAAGAGCGCGGGTCCCGGGTGGGCTCCAAGGCGCTGGTCCAGGCTGCGTCGGGGGTCCCGGTGGCCACGGTGTCGCAGGAGGAGGAGCCGACGCTGGAGAGTGCGCTGTCCTTCCCCTCGGCCACAAGCTGCCGCTCTATTCTGGTCTGTACCGGAATCTATAACCCCCACCGGGAAGTGCCGGCCGATACCTCCCGCTCCGTCACGGAGACGGTGTTCCACGGGCACCGGGATTTCCGCTTTGACCCCGCCCTAGTGGAACCCGGTCACATTGTGGATGATGTCAGCGCGGCGGTGGATTTAATCTTCCAATTAGAAGGCTTCGTACAACAGAGCGGCCCCAGGACTCATTAA
Full Trace Sequence: ggtgtttctgaggcagagtccggaggggccgcagctcggtgagaagccaaagcgggaatagaggcagcccgggccgggcggagaatgagtcgctggctgaggccggtgctgtcccgggtggtgagtcgggtcgggctgagcggagcggcccgggagcctcaggccgaggctcaggccaagtttgggctcctgttcgacatcgatggggtcctggtgcgaggcaagacccccatacccgccgccaggaaggccttccacaagctggtggattcccaggggcagttcctggttcccgtggtgtttgtaaccaacgccggaaactgcctgcgccagaccaaagccgaccagctctcccatatcctcggggtccccatctgccaggaccaagtgctgatgtcccacagtcccctgaggatatttaagcagtaccataacaagtgcgttctggtatcgggacagggccccctgctggacatcgccaaatatttaggattctcgaatcctatcacaattgactctctgagggagtcgtacccctttctggacatggtggaccacacgaggcgccccaaaatcctgccttcctcagccacagatctgcccaggatagaggctgtcgttctgttcggggaaccaatccggtgggagacaaacctgcagctcatcgttgatgtcctactgactggcggttaccctgtcaaccaccaccaacctgccagttacccccatatccccgtgctgggctgtaacatggatctgatgtggatggccgaggcccactcgccaaggtttggccacgggaccttcatggtttgcctggagaacatctacaagaagatcacggggaaggagctgaagtacgaggcgctgatgggcaaacccagtgaggtgacgttccagtacgcggagtatctgatccggacgcaggcggcgcagagacagtgggccgagccaatcagaacgctctatgcaatcggggacaatctgatgacggatatctatggcgctaacctgtacaaccgctacctgcaagagcgcgggtcccgggtgggctccaaggcgctggtccaggctgcgtcgggggtcccggtggccacggtgtcgcaggaggaggagccgacgctggagagtgcgctgtccttcccctcggccacaagctgccgctctattctggtctgtaccggaatctataacccccaccgggaagtgccggccgatacctcccgctccgtcacggagacggtgttccacgggcaccgggatttccgctttgaccccgccctagtggaacccggtcacattgtggatgatgtcagcgcggcggtggatttaatcttccaattagaaggcttcgtacaacagagcggccccaggactcattaaccctgcgaggggagcggattacctcagccagactccatttcctgcactttttataacccctccctgagccccctgtgtttataggaaaccctgtacattttattctatttattccccgcccaatagcgagagttttatttggcagcaggggagtggccctatcagactggcagtgggggcggagcttgtcagtctgcgcatgttccttctatatcttattgtacttaccctccccgtgggtaacaacccccctcccctattgcactgcaataattacccccccccccctttatttattattttccgggggcttttactctatttatagttttatttcggagaggactggcgccacaggcagaccccgcccactcacacttgaattttaattgttacttcaatggacggttattgccccccatgttggtgtgaccccccccccccgtgcctgttacacttttatgcaaatggttttacttcatctcctcaaataaacgccttgttcttttcaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSRWLRPVLSRVVSRVGLSGAAREPQAEAQAKFGLLFDIDGVLVRGKTPIPAARKAFHKLVDSQGQFLVPVVFVTNAGNCLRQTKADQLSHILGVPICQDQVLMSHSPLRIFKQYHNKCVLVSGQGPLLDIAKYLGFSNPITIDSLRESYPFLDMVDHTRRPKILPSSATDLPRIEAVVLFGEPIRWETNLQLIVDVLLTGGYPVNHHQPASYPHIPVLGCNMDLMWMAEAHSPRFGHGTFMVCLENIYKKITGKELKYEALMGKPSEVTFQYAEYLIRTQAAQRQWAEPIRTLYAIGDNLMTDIYGANLYNRYLQERGSRVGSKALVQAASGVPVATVSQEEEPTLESALSFPSATSCRSILVCTGIYNPHREVPADTSRSVTETVFHGHRDFRFDPALVEPGHIVDDVSAAVDLIFQLEGFVQQSGPRTH
Donor tissue: gastrula