ORFeome > chrna1 – XORFeome 2.0

chrna1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle), mRNA (cDNA clone MGC:76192 IMAGE:5335894), complete cds
Gene Symbol: chrna1
Gene ID: 394991
ORF gb_acc: MG132684
ORF ID: 9974

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064235

Library Location

Plate ID: GDExt11001
Well Location: H01

EST Sequences

Clone: MGC:76192 IMAGE:5335894
Trimmed Sequence: ATGGATTACACGGCCTCTTGCCTTATTTTCTTCTTTATTGCAGCTGGGCCAGTATTCAGTAGCGACCATGAAACTCGTCTCATTGGGGATCTGTTTGCCAACTACAACAAAGTGGTTCGCCCCGTAGAAACGTATAAGGATCAAGTGGTGGATGAAGTCAACCAAATTGTGTCAACAAATATCCGCCTAAAACAGCAATGGGTAGATGTTAACCTCAAATGGGACCCAGCAAAATACGGTGGCGTAAAGAAGCTTCGAATTCCTTCGAGTGAGGTTTGGTGCCCAGATTTGGTTCTTTATAACAATGCAGATGGTGACTTTGCCATTTCCAAGGACACTAAAATCCTTCTGGAACACACCGGAAAGATAACATGGACACCCCCAGCGATTTTCAAAAGCTACTGTGAAATTATAGTCACACACTTTCCATTTGACCAGCAGAACTGCAGCATGAAGTTTGGCACTTGGACTTATGATGGCACCTTAGTAGTTATAAACCCGGACAGGGACCGACCAGATCTGAGCAACTTCATGGCAAGTGGAGAATGGATGATGAAGGATTATCGCTGCTGGAAGCATTGGGTTTATTATACCTGTTGCCCAGATAAGCCATATCTGGATATTACCTACCACTTTGTCCTACAAAGGCTTCCCCTCTATTTCATTGTCAACGTCATCATTCCTTGTCTGCTCTTCTCTTTCCTCACTGGCTTAGTATTTTACCTGCCTACTGATTCAGGAGAGAAAATGACGCTAAGCATTTCTGTCTTACTGTCCCTGACTGTGTTCCTTCTGGTCATCGTCGAGCTGATCCCTTCAACATCGAGCGCTGTCCCTTTAATTGGGAAATACATGTTATTCACCATGGTCTTTGTCATCGCTTCTATCATTATCACAGTCATCGTCATCAACACCCATCACCGCTCCCCAAGCACTCACACCATGCCTCCGTGGGTGAGAAAGATTTTCATAGACACCATCCCAAACATTATGTTCTTCTCTACCATGAAACGTCCTTCACAAGAAAAACAGCCTCAGACAACATTTGCAGAAGAGATGGACATATCAGACATTTCAGGAAAGCTCGGCCCAGCCGCAGTGACTTATCAGTCCCCAGCTCTAAAGAACCCCGATGTAAAGAGTGCCATAGAGGGCATTAAATATATTGCTGAGACCATGAAGTCAGACCAGGAATCAAATAAGGCTTCTGAAGAATGGAAGTTCGTCGCTATGGTGTTGGATCATATCCTGCTCGCTGTCTTCATGACAGTCTGCGTCATAGGAACCTTGGCTGTGTTTGCCGGACGCATCATCGAAATGAACATGCAGGACTGA
Full Trace Sequence: agaggaagcaaatggattacacggcctcttgccttattttcttctttattgcagctgggccagtattcagtagcgaccatgaaactcgtctcattggggatctgtttgccaactacaacaaagtggttcgccccgtagaaacgtataaggatcaagtggtggatgaagtcaaccaaattgtgtcaacaaatatccgcctaaaacagcaatgggtagatgttaacctcaaatgggacccagcaaaatacggtggcgtaaagaagcttcgaattccttcgagtgaggtttggtgcccagatttggttctttataacaatgcagatggtgactttgccatttccaaggacactaaaatccttctggaacacaccggaaagataacatggacacccccagcgattttcaaaagctactgtgaaattatagtcacacactttccatttgaccagcagaactgcagcatgaagtttggcacttggacttatgatggcaccttagtagttataaacccggacagggaccgaccagatctgagcaacttcatggcaagtggagaatggatgatgaaggattatcgctgctggaagcattgggtttattatacctgttgcccagataagccatatctggatattacctaccactttgtcctacaaaggcttcccctctatttcattgtcaacgtcatcattccttgtctgctcttctctttcctcactggcttagtattttacctgcctactgattcaggagagaaaatgacgctaagcatttctgtcttactgtccctgactgtgttccttctggtcatcgtcgagctgatcccttcaacatcgagcgctgtccctttaattgggaaatacatgttattcaccatggtctttgtcatcgcttctatcattatcacagtcatcgtcatcaacacccatcaccgctccccaagcactcacaccatgcctccgtgggtgagaaagattttcatagacaccatcccaaacattatgttcttctctaccatgaaacgtccttcacaagaaaaacagcctcagacaacatttgcagaagagatggacatatcagacatttcaggaaagctcggcccagccgcagtgacttatcagtccccagctctaaagaaccccgatgtaaagagtgccatagagggcattaaatatattgctgagaccatgaagtcagaccaggaatcaaataaggcttctgaagaatggaagttcgtcgctatggtgttggatcatatcctgctcgctgtcttcatgacagtctgcgtcataggaaccttggctgtgtttgccggacgcatcatcgaaatgaacatgcaggactgaacaaagtgcttgttttgattttttaatgtcaaattagacaggaggactagttttatcgccactcttgcattcactttgagcctacagttttgccatctcaacaatagcaactatgtaccatcccaagctcataacttactgtacctttaggtacaaagaaacatacaatattgttagaataatgaccctgctttgtgcaacaacttggcatttatcccacatctttgcctgattgctactcaagctgagctgcccattagcaagggccacacaatcatattgctataagcacaggtgagcttcaagtccttgtttgggcattctagttcagcaacagctgttgggccacgggctgggcattccttatgtgagtgcagttccacagagattaatgttcaatacagcatcattgtgttttttttctactttgatattctataaggatatagcatagaataaataaatataatagctacaataaatacaatattgaagaaaaaaaaaaaaaaaaa
Translation: MDYTASCLIFFFIAAGPVFSSDHETRLIGDLFANYNKVVRPVETYKDQVVDEVNQIVSTNIRLKQQWVDVNLKWDPAKYGGVKKLRIPSSEVWCPDLVLYNNADGDFAISKDTKILLEHTGKITWTPPAIFKSYCEIIVTHFPFDQQNCSMKFGTWTYDGTLVVINPDRDRPDLSNFMASGEWMMKDYRCWKHWVYYTCCPDKPYLDITYHFVLQRLPLYFIVNVIIPCLLFSFLTGLVFYLPTDSGEKMTLSISVLLSLTVFLLVIVELIPSTSSAVPLIGKYMLFTMVFVIASIIITVIVINTHHRSPSTHTMPPWVRKIFIDTIPNIMFFSTMKRPSQEKQPQTTFAEEMDISDISGKLGPAAVTYQSPALKNPDVKSAIEGIKYIAETMKSDQESNKASEEWKFVAMVLDHILLAVFMTVCVIGTLAVFAGRIIEMNMQD
Donor tissue: tailbud