ORFeome > copg – XORFeome 2.0

copg – XORFeome 2.0

General Information

Species: Xenopus tropicalis coatomer protein complex, subunit gamma, mRNA (cDNA clone MGC:76032 IMAGE:5384920), complete cds
Gene Symbol: copg
Gene ID: 394781
ORF gb_acc: MG133516
ORF ID: 11041

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC063375

Library Location

Plate ID: GDExt11010
Well Location: G04

EST Sequences

Clone: MGC:76032 IMAGE:5384920
Trimmed Sequence: ATGCTGAAGAAGTTCGATAAAAAGGATGAGGAGTCGGGGGGCAGCTCCAACCCTTTCCAGAACCTTGAAAAGAGTGCAGTGCTCCAGGAGGCTCGTCTGTTCAACGAGACTCCAATTAACCCTCGAAAATGTGCTCACATCTTGACAAAGATACTATATTTAATAAACCAGGGTGAGCACATGGGTGCCACAGAAGCAACAGAAGCTTTCTTTGCCATGACCAAACTGTTCCAGTCAAACGATCCCACACTTCGCAGAATGTGTTACCTCACTATAAAGGAGATGTCAAGCATTTCTGAGGATGTAATTATTGTGACGAGTAGTTTAACCAAAGATATGACTGGGAAGGATGACAGCTACAGAGGTCCAGCTGTGAGAGCACTCTGCAAAATCACAGATAGTACCATGCTACAGGCCATTGAACGTTACATGAAACAGGCCATAGTAGACAAAGTATCCAGTGTGTCCAGCTCTGCCCTCGTCTCCTCATTGCACCTACTGAAAACCAGTTTTGACGTAGTCAAACGTTGGGTAAATGAGGCTCAAGAGGCAGCTTCCAGTGATAATATAATGGTTCAGTATCATGCTCTGGGCCTGCTGTACCACGTGCGAAAAAATGACCGGCTGTCTGTTAACAAGATGCTGAGCAAATTTATGCGTCATGGTCTGAAGTCCCCATTTGCCTATTGCATGATGATTCGTGTGGCTAGCAAGCTGTTGGATGAAGAGGATGGGAGTCGGGACAGTCCTTTGTTTGATTTTATTGAGAGCTGTCTGAGAAACAAGCATGAAATGGTTGTCTATGAAGCTGCTTCAGCTATTGTGAACCTACCTTCCTGCACTGCCAAAGAGCTTGCTCCCGCTGTGTCTGTGTTGCAGCTGTTCTGCAGTTCCCCAAAAGCTGCCCTTCGATATGCTGCTGTCCGTACTCTTAATAAGGTGGCCATGAAACACCCATCAGCAGTAACTGCCTGCAACCTGGACTTAGAGAACCTGGTGACTGACTCTAACCGCAGCATAGCTACCCTAGCCATCACTACCCTGCTGAAAACTGGCAGCGAGAGCAGCATCGATCGACTCATGAAACAGATTTCATCCTTCATGTCAGAAATCTCTGATGAGTTCAAGGTGGTAGTGGTTCAAGCAATTAATGCTCTCTGTCACAAGTATCCACGCAAGCATTCTGTCATGATGAATTTCCTGTTCACTATGCTGAGAGAAGAGGGAGGATTCGACTATAAGCGAGCAATTGTTGACTGTATAATCAGCATCATTGAAGAGAACCCTGAAAGCAAGGAGACAGGGCTGTCACACCTTTGTGAATTTATTGAGGACTGTGAGTTTACAGTTCTGGCCACTCGTATCCTTCACCTTCTGGGACAGGAAGGCCCAAGAACCAACAATCCATCGAAATATATTCGCTTTATCTACAACCGAGTTATACTGGAAAATGAAGAAGTTCGAGCAGGAGCTGTCAGTGCTTTGGCCAAATTTGGAGCCCAGAATGAAGATATGTTGCCCAGCATATTGGTACTATTAAGGAGGTGTGTGATGGATGATGATAATGAAGTGAGAGATCGAGCCACCTTCTATCTAAGCATTCTAGAGCACAGGCAGAAAGCTCTCAATTCTACATACATCCTTAACGGTTTGACTGTATCAGTGCCTGGGCTGGAGAGAGCTTTGCAGCAGTACACTTTGGAGCCTTCTGAGAAACCATTCGACCTAAAATCCGTACCTTTGGCTACTGCACCCCTGGCAGAACAAAGAGCAGATAATGTGCCTGCCGCAACAGTCAGGCAGCCGGAAAAATTGGTATCCAGCAGACAAGAGATATTCCAAGAACAACTTGCTGCCGTTCCAGAGTTTAAAGAGCTTGGGCCTTTGTTCAAGTCATCTGCAGAGCCTGTGGCCCTAACTGAATCTGAGACAGAATATGTAATCCGTTGTACTAAGCACACTTTTGTTAATCACATGGTGTTCCAGTTTGATTGCACCAATACCCTGAATGATCAGATACTGGAGAATGTCACAGTACAGATGGAGCCTACAGAGGGATATGAAGTTATTTGCTGTGTACCTGCTAAAACCCTATCATACAACCAGCCTGGCATATGCTATACCTTGGTATCTGTTCCTGAGGAGGATCCAAATACATTGGCGTGTACATTCAGTTGCTTGCTGAAATTCACAGTAAAGGATTGTGACCCCAACACGGGTGAGGCTGATGATGAAGGCTATGAGGATGAATATGTGCTAGAAGACATCGAGGTGACAGTTGCCGATCACATACAGAAAATCCTGAAGCCCAACTTTGGTGCAGCGTGGGATGAGGTGGGGGATGAGTTTGATAAAGAAGAAACTTTTAACTTATCCACCATCAAAACACTAGAAGAGGCTGTTGGTAATGTTGTGAAGTTCCTGGGAATGCAGCCCTGTGAGAGATCAGATAAAGTGCCAGAAAACAAGAATGCACATACTCTCTACCTAGCAGGTGTGTTTCGCGGAGGGCACGACATCTTGGTACGGGCCAAACTGGTGCTCACAGACACTGTTACAATGCAAGTTACTGCCCGCAGCAAAGATGAGTTTCCAGTCGACGTCATCATGGCCTCCGTGGGCTAA
Full Trace Sequence: tgcttgttagtgcgcatgcgtaggttacgttgtcaggagtgacgtgtcccggtgacagcctggcaggaagtggcctggttctgactgaggggcagagatgctgaagaagttcgataaaaaggatgaggagtcggggggcagctccaaccctttccagaaccttgaaaagagtgcagtgctccaggaggctcgtctgttcaacgagactccaattaaccctcgaaaatgtgctcacatcttgacaaagatactatatttaataaaccagggtgagcacatgggtgccacagaagcaacagaagctttctttgccatgaccaaactgttccagtcaaacgatcccacacttcgcagaatgtgttacctcactataaaggagatgtcaagcatttctgaggatgtaattattgtgacgagtagtttaaccaaagatatgactgggaaggatgacagctacagaggtccagctgtgagagcactctgcaaaatcacagatagtaccatgctacaggccattgaacgttacatgaaacaggccatagtagacaaagtatccagtgtgtccagctctgccctcgtctcctcattgcacctactgaaaaccagttttgacgtagtcaaacgttgggtaaatgaggctcaagaggcagcttccagtgataatataatggttcagtatcatgctctgggcctgctgtaccacgtgcgaaaaaatgaccggctgtctgttaacaagatgctgagcaaatttatgcgtcatggtctgaagtccccatttgcctattgcatgatgattcgtgtggctagcaagctgttggatgaagaggatgggagtcgggacagtcctttgtttgattttattgagagctgtctgagaaacaagcatgaaatggttgtctatgaagctgcttcagctattgtgaacctaccttcctgcactgccaaagagcttgctcccgctgtgtctgtgttgcagctgttctgcagttccccaaaagctgcccttcgatatgctgctgtccgtactcttaataaggtggccatgaaacacccatcagcagtaactgcctgcaacctggacttagagaacctggtgactgactctaaccgcagcatagctaccctagccatcactaccctgctgaaaactggcagcgagagcagcatcgatcgactcatgaaacagatttcatccttcatgtcagaaatctctgatgagttcaaggtggtagtggttcaagcaattaatgctctctgtcacaagtatccacgcaagcattctgtcatgatgaatttcctgttcactatgctgagagaagagggaggattcgactataagcgagcaattgttgactgtataatcagcatcattgaagagaaccctgaaagcaaggagacagggctgtcacacctttgtgaatttattgaggactgtgagtttacagttctggccactcgtatccttcaccttctgggacaggaaggcccaagaaccaacaatccatcgaaatatattcgctttatctacaaccgagttatactggaaaatgaagaagttcgagcaggagctgtcagtgctttggccaaatttggagcccagaatgaagatatgttgcccagcatattggtactattaaggaggtgtgtgatggatgatgataatgaagtgagagatcgagccaccttctatctaagcattctagagcacaggcagaaagctctcaattctacatacatccttaacggtttgactgtatcagtgcctgggctggagagagctttgcagcagtacactttggagccttctgagaaaccattcgacctaaaatccgtacctttggctactgcacccctggcagaacaaagagcagataatgtgcctgccgcaacagtcaggcagccggaaaaattggtatccagcagacaagagatattccaagaacaacttgctgccgttccagagtttaaagagcttgggcctttgttcaagtcatctgcagagcctgtggccctaactgaatctgagacagaatatgtaatccgttgtactaagcacacttttgttaatcacatggtgttccagtttgattgcaccaataccctgaatgatcagatactggagaatgtcacagtacagatggagcctacagagggatatgaagttatttgctgtgtacctgctaaaaccctatcatacaaccagcctggcatatgctataccttggtatctgttcctgaggaggatccaaatacattggcgtgtacattcagttgcttgctgaaattcacagtaaaggattgtgaccccaacacgggtgaggctgatgatgaaggctatgaggatgaatatgtgctagaagacatcgaggtgacagttgccgatcacatacagaaaatcctgaagcccaactttggtgcagcgtgggatgaggtgggggatgagtttgataaagaagaaacttttaacttatccaccatcaaaacactagaagaggctgttggtaatgttgtgaagttcctgggaatgcagccctgtgagagatcagataaagtgccagaaaacaagaatgcacatactctctacctagcaggtgtgtttcgcggagggcacgacatcttggtacgggccaaactggtgctcacagacactgttacaatgcaagttactgcccgcagcaaagatgagtttccagtcgacgtcatcatggcctccgtgggctaaacttgatttttaacttgtacactacagtctgtaaagggatttatacattttttttaggtctgaccgtaaattgcccaatagcagccagagggtgccttgaacgcatggaaacatctgggcagcgtgcttggtgcaactgctggaatagttatgtccgattttgttctatctattctttttgttttgctacggaattgtgcagtaatcatttaaatgtaaaaccattgagagccaattctattccccattattattatcagaaggggaaaaaaaataaactttaaaaaaaaaaaaaaaaaaaa
Translation: MLKKFDKKDEESGGSSNPFQNLEKSAVLQEARLFNETPINPRKCAHILTKILYLINQGEHMGATEATEAFFAMTKLFQSNDPTLRRMCYLTIKEMSSISEDVIIVTSSLTKDMTGKDDSYRGPAVRALCKITDSTMLQAIERYMKQAIVDKVSSVSSSALVSSLHLLKTSFDVVKRWVNEAQEAASSDNIMVQYHALGLLYHVRKNDRLSVNKMLSKFMRHGLKSPFAYCMMIRVASKLLDEEDGSRDSPLFDFIESCLRNKHEMVVYEAASAIVNLPSCTAKELAPAVSVLQLFCSSPKAALRYAAVRTLNKVAMKHPSAVTACNLDLENLVTDSNRSIATLAITTLLKTGSESSIDRLMKQISSFMSEISDEFKVVVVQAINALCHKYPRKHSVMMNFLFTMLREEGGFDYKRAIVDCIISIIEENPESKETGLSHLCEFIEDCEFTVLATRILHLLGQEGPRTNNPSKYIRFIYNRVILENEEVRAGAVSALAKFGAQNEDMLPSILVLLRRCVMDDDNEVRDRATFYLSILEHRQKALNSTYILNGLTVSVPGLERALQQYTLEPSEKPFDLKSVPLATAPLAEQRADNVPAATVRQPEKLVSSRQEIFQEQLAAVPEFKELGPLFKSSAEPVALTESETEYVIRCTKHTFVNHMVFQFDCTNTLNDQILENVTVQMEPTEGYEVICCVPAKTLSYNQPGICYTLVSVPEEDPNTLACTFSCLLKFTVKDCDPNTGEADDEGYEDEYVLEDIEVTVADHIQKILKPNFGAAWDEVGDEFDKEETFNLSTIKTLEEAVGNVVKFLGMQPCERSDKVPENKNAHTLYLAGVFRGGHDILVRAKLVLTDTVTMQVTARSKDEFPVDVIMASVG
Donor tissue: gastrula