ORFeome > csnk1a1 – XORFeome 2.0

csnk1a1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis casein kinase 1, alpha 1, mRNA (cDNA clone MGC:69552 IMAGE:5378973), complete cds
Gene Symbol: csnk1a1
Gene ID: 407897
ORF gb_acc: MG133355
ORF ID: 10858

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067926

Library Location

Plate ID: GDExt11009
Well Location: G01

EST Sequences

Clone: MGC:69552 IMAGE:5378973
Trimmed Sequence: ATGGCGAGTAGCAGCGGCTCCAAAGCTGAGTTTATTGTCGGTGGGAAATACAAGCTTGTGCGGAAGATCGGATCTGGCTCTTTTGGAGACATTTACCTGGCGATCAATATCACCAATGGCGAGGAAGTAGCTGTAAAGCTGGAATCACAGAAAGCTCGCCACCCCCAGTTGTTGTATGAAAGCAAATTGTACAAGATACTTCAAGGAGGTGTTGGAATCCCTCATATCCGGTGGTATGGACAAGAAAAGGATTATAATGTTCTAGTTATGGACCTGCTTGGACCCAGTCTTGAGGATCTCTTCAATTTTTGCTCGCGTAGGTTCACAATGAAGACAGTACTTATGTTAGCGGATCAGATGATAAGTAGAATTGAATATGTACACACAAAGAATTTTATACACAGAGACATTAAACCAGACAACTTCCTAATGGGCATCGGACGTCACTGTAATAAGTTATTCCTTATAGACTTTGGTTTGGCCAAAAAGTACAGAGACAACAGGACGAGGCAGCACATACCTTACAGAGAAGACAAAAATCTTACTGGCACGGCTCGCTATGCTAGTATAAATGCTCACCTAGGAATTGAGCAAAGTCGCCGTGATGATATGGAGTCTCTAGGGTACGTGCTAATGTATTTCAACAGAACCAGCCTTCCATGGCAGGGATTAAAGGCAGCTACAAAGAAGCAAAAGTATGAAAAGATAAGTGAAAAGAAGATGTCCACTCCAGTTGAGGTATTGTGTAAGGGGTTTCCTGCAGAATTTGCAATGTATCTGAACTACTGCCGCGGCTTACGATTTGAAGAGGCACCAGACTACATGTATCTGCGACAACTATTCCGTATTCTGTTCAGAACTTTGAACCACCAATATGACTACACGTTTGACTGGACAATGTTAAAGCAGAAGGCAGCTCAGCAAGCAGCCTCCTCCAGTGGGCAGGGCCAGCAAGCCCAAACCCCCACAGGGTTTTGA
Full Trace Sequence: gcttgaggaggagcaggagaggggttgcggttgtattagagggtgggaagtcgatagatgagcgtgtgactgagggtcggaaagccatcagaggtacacaccgctccgagagaggggattcggggcggagaagaagtggggggttgtacagaaagaacggaaacgggcgcccggtgaccccccttacaccgaacaaagaacccagggaacgcggatattcttgtccctaagccgaaggatctgctgttctcactactagtcgcatatctctgtttgactccattgtaattgttctgctttatcgctggggatccctcccccttccaccccggatcatggcgagtagcagcggctccaaagctgagtttattgtcggtgggaaatacaagcttgtgcggaagatcggatctggctcttttggagacatttacctggcgatcaatatcaccaatggcgaggaagtagctgtaaagctggaatcacagaaagctcgccacccccagttgttgtatgaaagcaaattgtacaagatacttcaaggaggtgttggaatccctcatatccggtggtatggacaagaaaaggattataatgttctagttatggacctgcttggacccagtcttgaggatctcttcaatttttgctcgcgtaggttcacaatgaagacagtacttatgttagcggatcagatgataagtagaattgaatatgtacacacaaagaattttatacacagagacattaaaccagacaacttcctaatgggcatcggacgtcactgtaataagttattccttatagactttggtttggccaaaaagtacagagacaacaggacgaggcagcacataccttacagagaagacaaaaatcttactggcacggctcgctatgctagtataaatgctcacctaggaattgagcaaagtcgccgtgatgatatggagtctctagggtacgtgctaatgtatttcaacagaaccagccttccatggcagggattaaaggcagctacaaagaagcaaaagtatgaaaagataagtgaaaagaagatgtccactccagttgaggtattgtgtaaggggtttcctgcagaatttgcaatgtatctgaactactgccgcggcttacgatttgaagaggcaccagactacatgtatctgcgacaactattccgtattctgttcagaactttgaaccaccaatatgactacacgtttgactggacaatgttaaagcagaaggcagctcagcaagcagcctcctccagtgggcagggccagcaagcccaaacccccacagggttttgaacacaaaaggagcagtcatcacagaccaggctggagctggagctggacctgtcactcccctgaaacctagagatttttagttcatatgtacacttgccagttgtcgtcggagaccatttacttggtgtaaagctgaacttaatttccgtataaactggctacctgctgtgtccaatatgccgaaagtagccgctgttaataattgtgaatatcactaagattagtgaaacatggtgtccagttttctattgcgttccctcccccctccccgaaagcgtgggacaggtggttcagatattaagtgttggcagacttgtggaagaaattgtgcatatgccaattttttttggttttttttttcgttttactatggttaacctcctgatccttacactgcttaagacttctactacttgagaagaaaggcatgagctggtttcctaaaggccattgtataaaagaaacaaaactctcattgtttccgcatttctcttttcttcactcgttatcacctttttttaattgtacacttaaaacattcttaactgtttcactgtttaaaatatctacagtctggtagaggtgcaccttcagtgaatgagttaaatcattttttgtttttccttttgccaccttatggttattatggtgaccgcatggtttcggattatttggaccttgtggcactgcagctcatgtttaggagcttgtctcctaaacagtgtaatagaaaataaattatctttgccagatcttggtagtctgaaaccatcttgtctccttaatttaaccaaagattacagtttttaggcaaaccatatgactgtgttttttgtttttctttttttaaaggataagttagggtgcagacataagacacagcttagcttgcttttctttagagaatggaatttaactgttcatgttgtaaaaggaaaaactgcagcatattgttcacaatctagataacatcttacaactaaagcttgtttaagtggcttaggaaatgtaatcactgtaaacatgatctgggatacctttgtttttattttgaacatttttgtttgtttacatgttcattaaaaactaaaatttaaaaaaaaaaaaaaa
Translation: MASSSGSKAEFIVGGKYKLVRKIGSGSFGDIYLAINITNGEEVAVKLESQKARHPQLLYESKLYKILQGGVGIPHIRWYGQEKDYNVLVMDLLGPSLEDLFNFCSRRFTMKTVLMLADQMISRIEYVHTKNFIHRDIKPDNFLMGIGRHCNKLFLIDFGLAKKYRDNRTRQHIPYREDKNLTGTARYASINAHLGIEQSRRDDMESLGYVLMYFNRTSLPWQGLKAATKKQKYEKISEKKMSTPVEVLCKGFPAEFAMYLNYCRGLRFEEAPDYMYLRQLFRILFRTLNHQYDYTFDWTMLKQKAAQQAASSSGQGQQAQTPTGF
Donor tissue: tailbud