ORFeome > ctnnbl1 – XORFeome 2.0

ctnnbl1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis catenin, beta like 1, mRNA (cDNA clone MGC:76112 IMAGE:5308765), complete cds
Gene Symbol: ctnnbl1
Gene ID: 394960
ORF gb_acc: MG132727
ORF ID: 10025

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064212

Library Location

Plate ID: GDExt11001
Well Location: B05

EST Sequences

Clone: MGC:76112 IMAGE:5308765
Trimmed Sequence: ATGGATGTGGGGGAGTTGTTGCGGTACCAGCCGGACAGAGGCACAAAACGAGGGCGAGATGATGAACCGGAAGACTTGAGACCACCGAGAAAAGAAAGAGGAGGGAGGAACTGGCACCGAGATGAGGAACGGGGGCCAACTGCAGAGGAGGATAGGAACGCATTGGATGATGGTGATGATGAGGAAGAGAATGAAACACTGGATGAGGGTGCAGTGAAAAGGATGATCCTGAATTTCGAAAAGAGATCCTACAAGAACCAAGAACTACGTATCAAATTCCCAGACAACCCTGAGAAGTTCATGGAGTCAGAACTAGACCTGAATGATATTATCCAGGAGATGCATGTTATTGCCACTATACCAGATCTGTACCATCTACTTGTGGAGCTCAATGCTGTGCAGTCACTGCTTGGCTTGTTAAGCCATGAGAACACTGATGTGTGCATTGCTGTGGTTGACCTGCTGCAGGAACTAACGGATATTGACACACTTCATGAGAGCGAAGAGGGTGCCCAGGTCCTTATAGATGCACTGTTGGAAGGTCAAGTCGTTGCTCTCCTGGTGCAGAATCTGGAACGCCTGGATGAATCTACGAAGGAGGAGGCAGATGGAGTTCACAATACCCTAGCAATCACTGAGAATATGACGGAGTTTCGCCCTGAAATATGCTCAGACGCTGCACAGCAGGGACTCCTCCATTGGCTGCTCAAAAGACTGAAGGCCAAGATGCCGTTTGATGCCAACAAGCTGTACTGCAGTGAGATCCTGGCCATTCTTTTACAGAACAACGATGACACTCGGGAGCTACTGGGGGAGCTGGACGGAATAGATGTGCTGCTTCAGCAGTTGTCGGTTTTTAAGCGCCATGATCCAGGAACAGCAGAAGAGCAGGAGATGATGGAGAATCTTTTTGATGCACTTTGCTCCTGTCTGATGCTGAGCAGCAACAGAGACAGGTTCCTGAAGGGAGAGGGTCTGCAGCTCATGAACCTCATGCTCCGCGAGAAAAAAATGTCCCGTTGCAGTGCCCTGCGGGTATTAGATCACGCCATGATCGGCCCAGAGGGTACAGATAATTGTCACAAGTTTGTCGACATCCTCGGACTCCGAACCATCTTTCCTCTTTTCATGAAATCTCCCAAAAAAGCAAAGAAAACCGGCGTCTCTGAGAAGGAGCATGAGGAACACGTGTGCTCCATCCTGGCCTCGCTGCTGCGGAACCTGAGGGGTCAGCAGAGGACACGGCTTCTCAGCAAGTTCACAGAAAGTGACTGCGAAAAGGTGGATCGGCTCATGGAGTTGTACTTTAAATACCTGGAGGCTGTACGGGTGGCTGACAAGAAGATCGAGGGAGAGAAGCATGATATGGTGCGCCGAGGGGAGATTTTAGATGATGATGTCGAGGAGGAGTTTTACTTGCGAAGATTGGATGCCGGCCTCTTCCTGCTTCAGCTCCTGTGTTACGTCACAGCGGAGATCTGTAACAACAACCTGCCGCAGATTCGCCAGAGAGTGCTGCAAATTCTAAACATGAGGGGAAGCTCTGTGAAAATCATGAGACATATTCTAAAAGAATACTCTGAGAGCATTGGTGATGGGAAGAGCGAAGAGTTCCGGGAAAGTGAGCAAAAGAGAATTCAGGAGCTGCTGGAGACGCTATAA
Full Trace Sequence: gcggctgagatggatgtgggggagttgttgcggtaccagccggacagaggcacaaaacgagggcgagatgatgaaccggaagacttgagaccaccgagaaaagaaagaggagggaggaactggcaccgagatgaggaacgggggccaactgcagaggaggataggaacgcattggatgatggtgatgatgaggaagagaatgaaacactggatgagggtgcagtgaaaaggatgatcctgaatttcgaaaagagatcctacaagaaccaagaactacgtatcaaattcccagacaaccctgagaagttcatggagtcagaactagacctgaatgatattatccaggagatgcatgttattgccactataccagatctgtaccatctacttgtggagctcaatgctgtgcagtcactgcttggcttgttaagccatgagaacactgatgtgtgcattgctgtggttgacctgctgcaggaactaacggatattgacacacttcatgagagcgaagagggtgcccaggtccttatagatgcactgttggaaggtcaagtcgttgctctcctggtgcagaatctggaacgcctggatgaatctacgaaggaggaggcagatggagttcacaataccctagcaatcactgagaatatgacggagtttcgccctgaaatatgctcagacgctgcacagcagggactcctccattggctgctcaaaagactgaaggccaagatgccgtttgatgccaacaagctgtactgcagtgagatcctggccattcttttacagaacaacgatgacactcgggagctactgggggagctggacggaatagatgtgctgcttcagcagttgtcggtttttaagcgccatgatccaggaacagcagaagagcaggagatgatggagaatctttttgatgcactttgctcctgtctgatgctgagcagcaacagagacaggttcctgaagggagagggtctgcagctcatgaacctcatgctccgcgagaaaaaaatgtcccgttgcagtgccctgcgggtattagatcacgccatgatcggcccagagggtacagataattgtcacaagtttgtcgacatcctcggactccgaaccatctttcctcttttcatgaaatctcccaaaaaagcaaagaaaaccggcgtctctgagaaggagcatgaggaacacgtgtgctccatcctggcctcgctgctgcggaacctgaggggtcagcagaggacacggcttctcagcaagttcacagaaagtgactgcgaaaaggtggatcggctcatggagttgtactttaaatacctggaggctgtacgggtggctgacaagaagatcgagggagagaagcatgatatggtgcgccgaggggagattttagatgatgatgtcgaggaggagttttacttgcgaagattggatgccggcctcttcctgcttcagctcctgtgttacgtcacagcggagatctgtaacaacaacctgccgcagattcgccagagagtgctgcaaattctaaacatgaggggaagctctgtgaaaatcatgagacatattctaaaagaatactctgagagcattggtgatgggaagagcgaagagttccgggaaagtgagcaaaagagaattcaggagctgctggagacgctataacacctaccggcctcctacaaatgcaccctaaataccttgccccgaaggatctatatgtaaatagaacttttaacatttggatttgccattttttcctgcaacccaccctctgtccatctgctacattttttttttgtcttttgacgtgagtccaaggtgatgccatccaaatgtccatgtttggtatttttatataaagtacagtaataataaaaaaaaaaaaaaaaa
Translation: MDVGELLRYQPDRGTKRGRDDEPEDLRPPRKERGGRNWHRDEERGPTAEEDRNALDDGDDEEENETLDEGAVKRMILNFEKRSYKNQELRIKFPDNPEKFMESELDLNDIIQEMHVIATIPDLYHLLVELNAVQSLLGLLSHENTDVCIAVVDLLQELTDIDTLHESEEGAQVLIDALLEGQVVALLVQNLERLDESTKEEADGVHNTLAITENMTEFRPEICSDAAQQGLLHWLLKRLKAKMPFDANKLYCSEILAILLQNNDDTRELLGELDGIDVLLQQLSVFKRHDPGTAEEQEMMENLFDALCSCLMLSSNRDRFLKGEGLQLMNLMLREKKMSRCSALRVLDHAMIGPEGTDNCHKFVDILGLRTIFPLFMKSPKKAKKTGVSEKEHEEHVCSILASLLRNLRGQQRTRLLSKFTESDCEKVDRLMELYFKYLEAVRVADKKIEGEKHDMVRRGEILDDDVEEEFYLRRLDAGLFLLQLLCYVTAEICNNNLPQIRQRVLQILNMRGSSVKIMRHILKEYSESIGDGKSEEFRESEQKRIQELLETL
Donor tissue: gastrula