ORFeome > dctn4 – XORFeome 2.0

dctn4 – XORFeome 2.0

General Information

Species: Xenopus tropicalis dynactin 4 (p62), mRNA (cDNA clone MGC:97564 IMAGE:6976370), complete cds
Gene Symbol: dctn4
Gene ID: 595065
ORF gb_acc: MG134433
ORF ID: 12133

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC093456

Library Location

Plate ID: GDExt11021
Well Location: E08

EST Sequences

Clone: MGC:97564 IMAGE:6976370
Trimmed Sequence: ATGGCGTCGCTACTCCAGTTAGAGAGAGTCTTGTATCTAGTGCACGGCGAGAAGCCTATTCGAGCGCCTCTCTCTCAGCTCTATTTTTGCCGATACTGCAGCGAGCTCCGCTCCCTAGAATGCGTCTCTCATGAGGTGGACTCGCACTACTGTCCCAGTTGTCTGGAAAATATGCCATCAGCCGAAGCAAAGCTGAAAAAGAACAGATGTGCTAACTGTTTTGACTGCCCTTGCTGTATGCACACACTTTCCACCCGGGCAACTAACATACCAGCCCCACTCCCAGATGATCCAGCCAAAACTACCATGAAGAAAGCCTATTACCTCGCCTGTGGATTTTGTCGTTGGACTTCCAGGGATGTTGGGATGGCTGACAAATCAGTTGCTAGTGGTGGGTGGCAGGAACCTGAGAATCCACACACACAAAGGATTAATAAGCTACTAGAGTATTACCAACAACTGGCACAGAAGGAGAAGATTGAGCGTGACAGAAAGAAACTGGTGCGTCGTCGCAACTATATGCCACTGGCGTTTTCTCAACACACTATTCATGTGGCGGATAAATATGGACGTGGAACCAGGCTCCAGCGACAGAGGCCAGGGGCGCCTATTACTGCCCTTACAGGACTGACTCTCAAAGAAGGCGAAGACCAGAAAGAGATAAAGATTGAGGCGGCACAAGCGATTGAAGAAGTGGAACCATTGCCAGAGGATTATTACACCAGGCCTATCAATCTGACTGAAGTTACTACTCTGGATCAGCGCTTGCTTCAACCAGATTTCCAGCCCATATGTGCCTCACAACTGCATCCTCGCCATAAACATCTCTTAATTAAGCGATCACTGCGATGCAGGAAATGTGAACATAATTTGAGCAAGCCTGAATTCAACCCAACATCCATCAAGTTTAAGATCCAGCTGGTGGCCCTGAGCTATGTTCCAGAAGTGAGGATTATGTCTATCCCCAATCTGCGTTACATGAAGGAAAGCCAGGTCCTCTTAACCTTAACTAACCCAGTGGAGAACCTCACTCATGTGAACCTTCTGCCATGTGAAGAGGGGGACCAAGATGAAATCAACAGCACAGCAAAGGTGATTGTACCAAACAAGGAGCTGATTCTCGCTGGTAAAGATGCGGCAGCAGAGTATGATGAGTTGGCTGAACCACAAGATTTTCAGGATGATCCAGATGTTGTTGCCTTTAGGAAGGCCAATAAAGTTGGGGTTTTTATCAAAGTCAGTCCTCTTCAAGAAAAAGGAAAAGTGATAGTGAGTTTCAAGCTCAAACATGACTTCCGAAACCTGGCAGCTCCTATCCGACCTCTTGAAGACAACGAATCCAGTTCAGAGGCAGTGTGGCTTACTCATCATGTGGAGCTTGACCTGGGGCCTGTGGTCCCACCTGCCCAGTAA
Full Trace Sequence: gctcaagatggcgtcgctactccagttagagagagtcttgtatctagtgcacggcgagaagcctattcgagcgcctctctctcagctctatttttgccgatactgcagcgagctccgctccctagaatgcgtctctcatgaggtggactcgcactactgtcccagttgtctggaaaatatgccatcagccgaagcaaagctgaaaaagaacagatgtgctaactgttttgactgcccttgctgtatgcacacactttccacccgggcaactaacataccagccccactcccagatgatccagccaaaactaccatgaagaaagcctattacctcgcctgtggattttgtcgttggacttccagggatgttgggatggctgacaaatcagttgctagtggtgggtggcaggaacctgagaatccacacacacaaaggattaataagctactagagtattaccaacaactggcacagaaggagaagattgagcgtgacagaaagaaactggtgcgtcgtcgcaactatatgccactggcgttttctcaacacactattcatgtggcggataaatatggacgtggaaccaggctccagcgacagaggccaggggcgcctattactgcccttacaggactgactctcaaagaaggcgaagaccagaaagagataaagattgaggcggcacaagcgattgaagaagtggaaccattgccagaggattattacaccaggcctatcaatctgactgaagttactactctggatcagcgcttgcttcaaccagatttccagcccatatgtgcctcacaactgcatcctcgccataaacatctcttaattaagcgatcactgcgatgcaggaaatgtgaacataatttgagcaagcctgaattcaacccaacatccatcaagtttaagatccagctggtggccctgagctatgttccagaagtgaggattatgtctatccccaatctgcgttacatgaaggaaagccaggtcctcttaaccttaactaacccagtggagaacctcactcatgtgaaccttctgccatgtgaagagggggaccaagatgaaatcaacagcacagcaaaggtgattgtaccaaacaaggagctgattctcgctggtaaagatgcggcagcagagtatgatgagttggctgaaccacaagattttcaggatgatccagatgttgttgcctttaggaaggccaataaagttggggtttttatcaaagtcagtcctcttcaagaaaaaggaaaagtgatagtgagtttcaagctcaaacatgacttccgaaacctggcagctcctatccgacctcttgaagacaacgaatccagttcagaggcagtgtggcttactcatcatgtggagcttgacctggggcctgtggtcccacctgcccagtaaagctaaatagctggcacctgtacaggagcacataactggggccaccagtgaataaggaataaggctagggtggtgttaccgctgctgagtggtgtttgtctaacaagaaaccgtgggagtgtgctagtgtgtctgccagtggcaaagcttttctgtcatttaggggagctctttaactctgtctgttatgccctgcacatgttgttcttgtcaaactacaaacatcaatatgctaaactgcccaaaaagatctgcacctcccacatttaacttgcacccgcaatgctgtttacttgtatttatatagtgtaactaaactgaatacgtatgctaagcttgaacaatggaagcacttcctagcatctccttacttgctagtttctctttatctggcatataggactatagttcatgaaacgtggcccttactaacaggcatttttttttgtttttgaccattattggaaaaaaatacacaagttcatgccattttacattaattcaatctattaatgcctactggctgggatctgtggcttcttccttctgtctagcttcccagcttcttttgaatggggatgctgtaagtacctcacagtaaagctgtctcattggaggaatacactgtaatagatatcagtgcttctgctccattattttgctaaggaacataatccagatctttggatttttaagagcaacatgaattcagctcaagcagtgtgtgaatcattgtccaaaaagcaagatatgtgctaaagccttatctattgtcaatttttaaaattaaaatgcaaaccttatagcagagtagtggcaaaccctgagaactgcatgatcttttagaactgttaatatgcctagcctggctgtttggggagaataaaatacactaaaattactgactcttattaccttattcagactgagattagtttttttttaaatctaattcagtcatttatttatagtttttaaattctgctgttttcagcactgtaaactcacctttgtccagctgggagcccatgggccaaatgcggcaattatgtggcctcatcagttccgtatattgctgctgttatgaagcttgacctgtaaatatcttggatcttcagcatgcatggcagtaggagctgtgttttacagggccagttaaaatggcaaaatgttacattctgttgctcttaaaagtgattatagctgttatatctgcaggcatctgttgtaatgtcagtagtaatttatcaaatgagctacagcctgggtaaaaaaataggtaagaataatgttctaaactaccagtcagtaggaatccctaaatatctatgattcttcagataaatgaatttcccttcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MASLLQLERVLYLVHGEKPIRAPLSQLYFCRYCSELRSLECVSHEVDSHYCPSCLENMPSAEAKLKKNRCANCFDCPCCMHTLSTRATNIPAPLPDDPAKTTMKKAYYLACGFCRWTSRDVGMADKSVASGGWQEPENPHTQRINKLLEYYQQLAQKEKIERDRKKLVRRRNYMPLAFSQHTIHVADKYGRGTRLQRQRPGAPITALTGLTLKEGEDQKEIKIEAAQAIEEVEPLPEDYYTRPINLTEVTTLDQRLLQPDFQPICASQLHPRHKHLLIKRSLRCRKCEHNLSKPEFNPTSIKFKIQLVALSYVPEVRIMSIPNLRYMKESQVLLTLTNPVENLTHVNLLPCEEGDQDEINSTAKVIVPNKELILAGKDAAAEYDELAEPQDFQDDPDVVAFRKANKVGVFIKVSPLQEKGKVIVSFKLKHDFRNLAAPIRPLEDNESSSEAVWLTHHVELDLGPVVPPAQ
Donor tissue: tailbud