ORFeome > dek – XORFeome 2.0

dek – XORFeome 2.0

General Information

Species: Xenopus tropicalis dek protein, mRNA (cDNA clone MGC:79831 IMAGE:6987174), complete cds
Gene Symbol: dek
Gene ID: 493252
ORF gb_acc: MG133756
ORF ID: 11325

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC079968

Library Location

Plate ID: GDExt11013
Well Location: A11

EST Sequences

Clone: MGC:79831 IMAGE:6987174
Trimmed Sequence: ATGTCTTCTGACACTGAATCCAATGCACTCACTAAAGAGGAATCTGAACAAATTGAAGAGGCTACCGAAGAAAAAATGACTGACGATGCAGAAAATGGAAAAGAGGAAGATGAAGAAGAAGAAGAGGAGGAAGATGATGAGGAGGAAGATGATGATGATAAAAAGGAGAAAAGCTTAATTGTAGAAGGGAAAAGGGAGAAGAAAAAGGTGGAAAGACTAAGCCTCGAGATGAATATATCTAAAAAGGAGTTTGTTCTGACTGAAGGAAAGGGACAGAAGTTATATGACATTGAACGTGTGCAGTACTTCCTGAGAAAGAAGAAGTGTGACGAACTAAGACCTTTACACAGACTACTTTTTAACCGTCTGGGCATAATCAATTTGGTCAAGAAAAATATTGGTCAGTTCAATGGATTCCCTTTTGAGAAAGACAGTGAGCAATACAAAAAAAAGGAAGAGATGCTTAAAAAATGGAAAAAAATTGATCTGAAGAATACCTGTGGTGTACTTGATCTTGAAAAATCTGGTTCCAACACTGAGCTGATCTCAAAAATTATGAATTTCCTCATGGAACCAAAGTCTACTGGAAAACCTTTACCAAAAACCAAAGGTAAATCTCCTAAAGCAAGTAAAAAAGACAGAAGCAGTTCAGGATCTGCACGCAAATCCAAGAGCAACAGATCAAGTGTTATTCTCTCTGATGAATCAAGCAGTGAAGATGAGAAAAAAGACAAGGAGGAATCTTCTGAGGAAGAAAAAGAAAGTGATGAAGAAGAAGAGCCACCGAAGAAAATTGCAAAAAAGGCAAAATCAAAGCCTAAATCAACACCCAAAGGCAAAAAAGCTGCAAAATCAGCAAATGTCAAAAAAGCTGACAGTAGTACTGCTAACAAGAAAAGTCAAGGAAATGCCAAAAAAGAAAAAGCTGTACAATCGGAGAGTGAATCAGATGACAGTTCAGATGATGAACCTTTAATCAAAAAAGTGAAGAAGCCACCTACAGATGAAGAGCTAAGAGAGACCGTGAAGAAGCTGTTAGCTGAGGCAAATCTGGAAGAAGTGACAATGAAACAAATCTGCAAGAAGGTGAATGAGAGCTACCCCAACTGTGATCTGTTTGCCAGGAAAAAATTCATCAAATCTACAGTTAAAGAGTTAATTTCATGA
Full Trace Sequence: gtcgtccttccctctgccgtcgttttacgtttgccagggggacctctggcctcctaccgcctctctcctgtcagcctgactgcgttaatataacagcgccttgtctccgcttccccgggcagctcgacatcactctgcgcatcccgggccgcccagagagaaagaaacatgtcttctgacactgaatccaatgcactcactaaagaggaatctgaacaaattgaagaggctaccgaagaaaaaatgactgacgatgcagaaaatggaaaagaggaagatgaagaagaagaagaggaggaagatgatgaggaggaagatgatgatgataaaaaggagaaaagcttaattgtagaagggaaaagggagaagaaaaaggtggaaagactaagcctcgagatgaatatatctaaaaaggagtttgttctgactgaaggaaagggacagaagttatatgacattgaacgtgtgcagtacttcctgagaaagaagaagtgtgacgaactaagacctttacacagactactttttaaccgtctgggcataatcaatttggtcaagaaaaatattggtcagttcaatggattcccttttgagaaagacagtgagcaatacaaaaaaaaggaagagatgcttaaaaaatggaaaaaaattgatctgaagaatacctgtggtgtacttgatcttgaaaaatctggttccaacactgagctgatctcaaaaattatgaatttcctcatggaaccaaagtctactggaaaacctttaccaaaaaccaaaggtaaatctcctaaagcaagtaaaaaagacagaagcagttcaggatctgcacgcaaatccaagagcaacagatcaagtgttattctctctgatgaatcaagcagtgaagatgagaaaaaagacaaggaggaatcttctgaggaagaaaaagaaagtgatgaagaagaagagccaccgaagaaaattgcaaaaaaggcaaaatcaaagcctaaatcaacacccaaaggcaaaaaagctgcaaaatcagcaaatgtcaaaaaagctgacagtagtactgctaacaagaaaagtcaaggaaatgccaaaaaagaaaaagctgtacaatcggagagtgaatcagatgacagttcagatgatgaacctttaatcaaaaaagtgaagaagccacctacagatgaagagctaagagagaccgtgaagaagctgttagctgaggcaaatctggaagaagtgacaatgaaacaaatctgcaagaaggtgaatgagagctaccccaactgtgatctgtttgccaggaaaaaattcatcaaatctacagttaaagagttaatttcatgattccagttttggacatggacaaaaagggattgttgaatatgttcctatggatcacaagctctgagtatctgacaccagcaaaatgtatttgtttttaccacttcgggtacaaagttttttttaagcaggattgctttatctctgtgtttgcttatgtaaattgctttattaaaaatgcctttttacagtgatttcagatggtgttttcttagccccttgttttctgtttcccacattgttgttttctttcccccagttgtaatatatttcctgttagacctttttaaggttgtggaaaagtccagaatttttctggtttattccaataatagataatttataattttgaaaaaaagcgagtataaaacaaataggcaaggcaatgtgatttataaaaatatacagatattttattcttgtattttcccctccagcataaacggatgtaattatgtcatttggaaggccagtgtccatgttttattttattgtaatatttgattattgggaactgcattataattgactttcacatgcctgcctaaatgctattacccttatttaaatgatgggatttttaataggaatgcatatatgaatttatcctttgcccttcacagactgcataggattttgttggacatactgcatgtagatgttgctatttttgtatttttatatatatatatattaaaactttacaaatataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSSDTESNALTKEESEQIEEATEEKMTDDAENGKEEDEEEEEEEDDEEEDDDDKKEKSLIVEGKREKKKVERLSLEMNISKKEFVLTEGKGQKLYDIERVQYFLRKKKCDELRPLHRLLFNRLGIINLVKKNIGQFNGFPFEKDSEQYKKKEEMLKKWKKIDLKNTCGVLDLEKSGSNTELISKIMNFLMEPKSTGKPLPKTKGKSPKASKKDRSSSGSARKSKSNRSSVILSDESSSEDEKKDKEESSEEEKESDEEEEPPKKIAKKAKSKPKSTPKGKKAAKSANVKKADSSTANKKSQGNAKKEKAVQSESESDDSSDDEPLIKKVKKPPTDEELRETVKKLLAEANLEEVTMKQICKKVNESYPNCDLFARKKFIKSTVKELIS
Donor tissue: gastrula