ORFeome > depdc7 – XORFeome 2.0

depdc7 – XORFeome 2.0

General Information

Species: Xenopus tropicalis DEP domain containing 7, mRNA (cDNA clone MGC:89737 IMAGE:7027157), complete cds
Gene Symbol: depdc7
Gene ID: 779629
ORF gb_acc: MG133101
ORF ID: 10525

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080467

Library Location

Plate ID: GDExt11005
Well Location: B03

EST Sequences

Clone: MGC:89737 IMAGE:7027157
Trimmed Sequence: ATGGCCACAGTGCGGGAGAAAGCGGTGTCTTTGAATCTATGTGCGACTTACAGCCCCGCACAGCGACCCCCAGGTCCAAATGGAAGCCATAGACCATTCCGAGCCACCTATATCTGGAGCAGCATCATCCAAGCTCTCACACAGGTAGAAGTGAAGAAGAGGCGGCACCACCTGAAGTACCACCATGACTGCTTTATCGGCTCTGAGGCCGTGGACGTTGTGTTTGCCCACCTGGTGCAGCACAAGTACTTTGGGGATACGGAGATTCCCCGCTCCAAGGTTGTGCGAGTGTGCCAGGCTCTCATGGACTGCAAAGTGTTTGAACCCATCGTGACGGCCTGCATGTTTGGGAGGGAGAAGAAGAGGACGGTGTTCGAGGATAGTAGCTGCAGCCTGTACCGATTTATAAACAATTCAAGCCATCTTGGTGCCCAGGTGGAGAAAAGCAATGGACGTTGGACCCCTCAGAGACCCAAACACTCAAGCTTCCAATCTGCGCCACTTAAGTCTCCAAGCCTGGAAGATCTGTGGGATAACCTCAGTCTGACAGCTGCAGACCCAACGCACATAAACCTCACAGCTAACCTACCTCCCAAAGTTGTCGGTGAAGTTTGGCAAGAACAGACCATCCGCCGACTTCTGCAGCTTGTAGACCTACCTCTGCTCGATTCCTTGTTGGAGTACACTCCTGTTGCTCCCAGAATTCCACAAGTGAAGGAAGAGGAGCTAAACCTCACCAGTAACTACCTGGACCGGGAGATCCTTAAAGCCTTCAGTGATGCTCAGGCAGATGAGTGGGTCTCAGCCGCGGTGGATTGCTTGGATTTTCTGCCGGACCACATGGTGGTAGACGTGAGCCGGAACCTCCCAGAGCAGCAGGCGCCAGACAGTAAATGGAAGCTGCTCCTGTTTGATACTATCGGCAAACACTACCAGAACCGGTCCCCGCTGCTCAGAAACCAGCTGTTCGATATTCATACTGGCATCGCCGAGCTGCTTGTGAATGGAAAGAATGAACCCGCTCTGGAGGCGACCCAGCTCTGCCTGAAGCTGTTGGACTCCCCGAGCCGCGAGGAGTTCAGACGCCTCCTGTATTTTATGGCTCTTGCGGCAGATCCTTCAGAGTTCCGACTGCACGAAGAGACTGACAACAGGATGACTGTGAAAAGAATGTTCTCTAGAGCCGTCGTCTGCAATAAGAACCTGTCCAAGGGGAAGTGCGACCTGCTGGTATTATTCATACTGGACCATCACAAGGATGTGTTTAAGATACCCGGCTCCTTGCACAAGATGGTCAGCGATAAACTGGTAGCAATTCAGCAAGGCAGCGATCCAGACCGAGACACAGGTTATACTTTCTGCCAAAGGGTGGACAAACGGGAATTTGATTCAGCCACGCAGAACAACACTCGGACGGAACTCTGCGCTTTGCTGAAGACCATTTACGAGAACACCAGCCTCTCCCCCAAAGAGAAGAAACGGCTCCTGGGCCAGTTCTACAAGAGCCACCCAGAGACTTTTATCCAGTACTTCGGAGACCGCGTGAGCAGCGTCTACACGTAG
Full Trace Sequence: ccagtgcagcagtaggagagcggaatggccacagtgcgggagaaagcggtgtctttgaatctatgtgcgacttacagccccgcacagcgacccccaggtccaaatggaagccatagaccattccgagccacctatatctggagcagcatcatccaagctctcacacaggtagaagtgaagaagaggcggcaccacctgaagtaccaccatgactgctttatcggctctgaggccgtggacgttgtgtttgcccacctggtgcagcacaagtactttggggatacggagattccccgctccaaggttgtgcgagtgtgccaggctctcatggactgcaaagtgtttgaacccatcgtgacggcctgcatgtttgggagggagaagaagaggacggtgttcgaggatagtagctgcagcctgtaccgatttataaacaattcaagccatcttggtgcccaggtggagaaaagcaatggacgttggacccctcagagacccaaacactcaagcttccaatctgcgccacttaagtctccaagcctggaagatctgtgggataacctcagtctgacagctgcagacccaacgcacataaacctcacagctaacctacctcccaaagttgtcggtgaagtttggcaagaacagaccatccgccgacttctgcagcttgtagacctacctctgctcgattccttgttggagtacactcctgttgctcccagaattccacaagtgaaggaagaggagctaaacctcaccagtaactacctggaccgggagatccttaaagccttcagtgatgctcaggcagatgagtgggtctcagccgcggtggattgcttggattttctgccggaccacatggtggtagacgtgagccggaacctcccagagcagcaggcgccagacagtaaatggaagctgctcctgtttgatactatcggcaaacactaccagaaccggtccccgctgctcagaaaccagctgttcgatattcatactggcatcgccgagctgcttgtgaatggaaagaatgaacccgctctggaggcgacccagctctgcctgaagctgttggactccccgagccgcgaggagttcagacgcctcctgtattttatggctcttgcggcagatccttcagagttccgactgcacgaagagactgacaacaggatgactgtgaaaagaatgttctctagagccgtcgtctgcaataagaacctgtccaaggggaagtgcgacctgctggtattattcatactggaccatcacaaggatgtgtttaagatacccggctccttgcacaagatggtcagcgataaactggtagcaattcagcaaggcagcgatccagaccgagacacaggttatactttctgccaaagggtggacaaacgggaatttgattcagccacgcagaacaacactcggacggaactctgcgctttgctgaagaccatttacgagaacaccagcctctcccccaaagagaagaaacggctcctgggccagttctacaagagccacccagagacttttatccagtacttcggagaccgcgtgagcagcgtctacacgtagcgacctcggcccatctctgtgtatagatctgtacaatgtctttgtaaatatgaatttgttaatatattgaataactaattgtttttgcacatttaataaactttcaaatattaaaaaaaaaaaaaaaa
Translation: MATVREKAVSLNLCATYSPAQRPPGPNGSHRPFRATYIWSSIIQALTQVEVKKRRHHLKYHHDCFIGSEAVDVVFAHLVQHKYFGDTEIPRSKVVRVCQALMDCKVFEPIVTACMFGREKKRTVFEDSSCSLYRFINNSSHLGAQVEKSNGRWTPQRPKHSSFQSAPLKSPSLEDLWDNLSLTAADPTHINLTANLPPKVVGEVWQEQTIRRLLQLVDLPLLDSLLEYTPVAPRIPQVKEEELNLTSNYLDREILKAFSDAQADEWVSAAVDCLDFLPDHMVVDVSRNLPEQQAPDSKWKLLLFDTIGKHYQNRSPLLRNQLFDIHTGIAELLVNGKNEPALEATQLCLKLLDSPSREEFRRLLYFMALAADPSEFRLHEETDNRMTVKRMFSRAVVCNKNLSKGKCDLLVLFILDHHKDVFKIPGSLHKMVSDKLVAIQQGSDPDRDTGYTFCQRVDKREFDSATQNNTRTELCALLKTIYENTSLSPKEKKRLLGQFYKSHPETFIQYFGDRVSSVYT
Donor tissue: