ORFeome > dlx5 – XORFeome 2.0

dlx5 – XORFeome 2.0

General Information

Species: Xenopus tropicalis distal-less homeobox 5, mRNA (cDNA clone MGC:69418 IMAGE:5335570), complete cds
Gene Symbol: dlx5
Gene ID: 447997
ORF gb_acc: MG133263
ORF ID: 10747

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074511

Library Location

Plate ID: GDExt11007
Well Location: F11

EST Sequences

Clone: MGC:69418 IMAGE:5335570
Trimmed Sequence: ATGACAGGAGTCTATGAGCGGAGAGTCGCCACCATCAGAGCCACTGAGTTCCAGAGCATCATGCACCATCCTTCCCAGGACTCACCAACACTGCCCGAATCCACAGCCACTGACTCTGGCTACTACAGCCCAGGAGGGGCAGCTGGCCACCCACACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTTAATGCTTATCAGTACCAGTACCATGGCATGAATGGAGCAGCGGGAAACTACCCTGGCAAAGCCTATAGCGATTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTACAACAGGGTGCAGCCCCCCAGCAGTCAGCCAGAAAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTGAATGGGAAACCAAAGAAAATCCGAAAGCCGCGCACCATCTACTCCAGTTTCCAGCTCGCAGCGCTACAGAGGCGCTTCCAGAAGACGCAATACTTAGCGCTGCCGGAGCGCGCAGAACTGGCGGCATCTCTGGGACTAACGCAAACACAGGTAAAAATATGGTTCCAGAATAAAAGATCCAAGATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGCCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTAGTGTGGGAACCCCAAGGATCTTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGGCCTCCGGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCCAGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAA
Full Trace Sequence: ccagcctcctcctcctctctctcttcctcctcctcctgctcagatcactaaggaaccttcccaagctctcactatttcagtgccagtcccagcagtagcagcagcatggccgcctgagcagcttcccagcgcccccaatgcaggcagatcgcagtccccagagcatgacaggagtctatgagcggagagtcgccaccatcagagccactgagttccagagcatcatgcaccatccttcccaggactcaccaacactgcccgaatccacagccactgactctggctactacagcccaggaggggcagctggccacccacaccatggctactgttcgcccacttcggccacttatggaaaggcgcttaatgcttatcagtaccagtaccatggcatgaatggagcagcgggaaactaccctggcaaagcctatagcgattatggctatgggagcccttaccaccctcaccaccagtacagcggagcgtacaacagggtgcagccccccagcagtcagccagaaaaagaagtatcagagcccgaggtgagaatggtgaatgggaaaccaaagaaaatccgaaagccgcgcaccatctactccagtttccagctcgcagcgctacagaggcgcttccagaagacgcaatacttagcgctgccggagcgcgcagaactggcggcatctctgggactaacgcaaacacaggtaaaaatatggttccagaataaaagatccaagattaagaaaatcatgaagaacggagagctgcctccagaacacagccccagctccagtgaccccatggcgtgtaattctccccagtctccagtagtgtgggaaccccaaggatcttcaaggtcactcagccaccacccccatgtacattcccacccccaggcctccggcagctcccctgcatcctcctatctggagaactccagcgtctggtaccctacaggcacccacctgcagaacctgcagaaccatgcctctttacagcaccccttggccttggcatcagggactctctactaaaagacacccgggccgcctttttgtctttttttggactatcatttttttcattgttaaggagtcatacaaaacaatgcataacatggattttttaaggcaaagtatattgtgtaaagcttgttgcatgtaacttattgcatttcaaaggagaccgtgtgttttttacagattgtctttgcgcaactggggacactatctcaatggtgccttgaatctatgacctcatttttttccagagactttttttcaatgtttattttaaccatgtaaatacatgtagatagaggaattaaactgtatattctggataaataaaattatttcgaccaggaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MTGVYERRVATIRATEFQSIMHHPSQDSPTLPESTATDSGYYSPGGAAGHPHHGYCSPTSATYGKALNAYQYQYHGMNGAAGNYPGKAYSDYGYGSPYHPHHQYSGAYNRVQPPSSQPEKEVSEPEVRMVNGKPKKIRKPRTIYSSFQLAALQRRFQKTQYLALPERAELAASLGLTQTQVKIWFQNKRSKIKKIMKNGELPPEHSPSSSDPMACNSPQSPVVWEPQGSSRSLSHHPHVHSHPQASGSSPASSYLENSSVWYPTGTHLQNLQNHASLQHPLALASGTLY
Donor tissue: tailbud