ORFeome > dnajb4 – XORFeome 2.0

dnajb4 – XORFeome 2.0

General Information

Species: Xenopus tropicalis dnajb4 protein, mRNA (cDNA clone MGC:89364 IMAGE:6988340), complete cds
Gene Symbol: dnajb4
Gene ID: 493474
ORF gb_acc: MG133914
ORF ID: 11507

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC081315

Library Location

Plate ID: GDExt11015
Well Location: G01

EST Sequences

Clone: MGC:89364 IMAGE:6988340
Trimmed Sequence: ATGGGGAAGGATTACTACAAAATCCTTGGAATCCCCAAAGGAGCGACGGAGGAAGAGATTAAGAAGGCGTACAGAAAGCAAGCTCTTAAATATCACCCAGATAAGAACAAGGACCCGGGAGCTGAGGATCGATTCAAAGAGATTGCGGAGGCCTACGATGTGCTCAGTGACCCTAAGAAGAGGGAAGTGTTTGATAAATATGGAGAAGAGGGCCTGAAGGGAACTCCTGGTGGTGGAGGAAGCAGCGGCGGCCCCAATGGTACCTATAGCTACACTTTCCACGGTGACCCTCATGCTGTCTTTGCCGAATTCTTCGGTGGTCGAAATCCATTTGACGGCTTTTTTGGACGCAATGATGACGATATGGATACAGACGATCCCTTTGCTGGCTTCGGTGGCATGGGGGGCTTCGGTGGCATGGGGGGAATGGGAGGAATGGGGGGCATGGGTGGCATGGGAGGCTTTCCTCGGTCTGCATCGGGTCGACGGGACACTGTACCCAGAAAGCAGGATCCTCCAATCACACGTGAACTCCCAGTATCTCTTGAGGAAGTGTTTAATGGTTGCACCAAAAAAATGAAAATCTCGCACAAGAGGCTGGGGCCCGATGGCAGAAGTGTGCGTAATGAGGACAAGATACTCACCATTCAGGTGAAAAAAGGCTGGAAAGAAGGCACCAAGATCACCTTCCCTAAAGAGGGTGACGAGACCCCCAGCAACATTCCTGCTGATATTGTCTTTGTGCTAAAAGACAAGTCTCATCCAGTGTTCAAAAGAGAAGGATCCGATGTGGTTTATACATCCAAAATCAGCCTGCGAGAGGCTCTATGTGGCTGTTCAGTAAACATCCCAACCGTGGATAACCGCACAATCCCGCTTACATTTACTGACATCATCCGTCCAGGAACCAAGAGGCGAATAACGAATGAAGGACTTCCCCTTCCTAAATCTCCCGATCAGCGCGGCGACTTAATTGTAGAGTTCGACATTCGGTTTCCGGAGAGGCTGACGGCCAGCTCCCGCGAAGTGTTGGAAAGGGTTCTTCCTGCATAA
Full Trace Sequence: gccgagagttgacaggaggagcatacggacaagcgattggtgctaaggtatcttcatagggtaatagaatacctgccaacatggggaaggattactacaaaatccttggaatccccaaaggagcgacggaggaagagattaagaaggcgtacagaaagcaagctcttaaatatcacccagataagaacaaggacccgggagctgaggatcgattcaaagagattgcggaggcctacgatgtgctcagtgaccctaagaagagggaagtgtttgataaatatggagaagagggcctgaagggaactcctggtggtggaggaagcagcggcggccccaatggtacctatagctacactttccacggtgaccctcatgctgtctttgccgaattcttcggtggtcgaaatccatttgacggcttttttggacgcaatgatgacgatatggatacagacgatccctttgctggcttcggtggcatggggggcttcggtggcatggggggaatgggaggaatggggggcatgggtggcatgggaggctttcctcggtctgcatcgggtcgacgggacactgtacccagaaagcaggatcctccaatcacacgtgaactcccagtatctcttgaggaagtgtttaatggttgcaccaaaaaaatgaaaatctcgcacaagaggctggggcccgatggcagaagtgtgcgtaatgaggacaagatactcaccattcaggtgaaaaaaggctggaaagaaggcaccaagatcaccttccctaaagagggtgacgagacccccagcaacattcctgctgatattgtctttgtgctaaaagacaagtctcatccagtgttcaaaagagaaggatccgatgtggtttatacatccaaaatcagcctgcgagaggctctatgtggctgttcagtaaacatcccaaccgtggataaccgcacaatcccgcttacatttactgacatcatccgtccaggaaccaagaggcgaataacgaatgaaggacttccccttcctaaatctcccgatcagcgcggcgacttaattgtagagttcgacattcggtttccggagaggctgacggccagctcccgcgaagtgttggaaagggttcttcctgcataaggaccaagccttccctaaggcaccgtgaccaaagcagaactggttcatttaactgtttcagctccagagggcctgggaatggggaaaaatgatggttaggggtgccacatcctaattgtgatcacatcttcatttattccctgattatatttctattccatgaatctaattcagcactttgtaatattaatggacgattaatgggaagcgttttgggagtggcagtgctggtagtttgagttaagccacaattgaaatactttttgggtccaggaatttattcagtatactgtcactccgaaaacccctaatttctggtgctgttgagttgggcgactgtagttgtcttttgtctagtggcgagatattgtgcctccgtgctgaatgccattaaactggaagcagccactgcatcaagtgtcaatgacagatcgaatactggtacttatgtgggaaccaccctctgttgcctctttctgcctgttaaatgggcagcttaggggcaagtcgggcagctttttttattgctgtctgcactcactaaagctgcccatacatgccaggatttagtcgggcagttaggacgatttaaccacctttagactattgagaagtccatttattttgttactctttctggaaattcaagttgagggataaaaactggatcatatttcagacacaaaataccttgtacaaggatttcattgctgcgattttttcactttcatatattccactccattgtgctgcattgctgcagtgccagagggccccctttatagaaaatcctgatagagaagggctttctgcgtgttgccatgcaagattgttatatttgcgtaatgtgttgggttggtttttttaagtgtgtgcaacatgattttattccactttcagcgtcaggaattgctctgtatgtatggctatgttgttttatacggatacaataaatatacatacagatataatgggaactgactcgcctctcaaaaacggaaaattgtattttctattttgttgttgcaaaaagaataactggaggcatgtatgttactggaatgtttattttttaataatgcattgcattaataaccacaatgtagggtttttataacgatgctggagtcccactctcccctcccacaatggaatttttgggtggagcttaggatatcggttgcatggcctatatattgctggttgcagccttgctcttatggaagcctgtctccattgtcggggtgggtatggaactgtttccgtgtatttatatgttatgcatatctgtactatgttttgtaaagtttttttgtttttgtatataaatagtttttctggaagatgccattgtggcattgatataaaaaaaaaaccgaatccaggtgatattggcttataaagctggtaagcgacaagtcgctaataggggatacattgacaagcaaagggcaagtgatactcggcagttatactaaggttctaaggcagggttccccaacctttttcacccgtgagccacattcaaatgtaaaaagacttggggagcaacacgagcataaaacatgttcctggggtgccaaataatgactgtaattggctatttggtagcccctatatggactggcaacctacaggagactctggcagtacatcaggtttttatgcaaccaaaacttgcctccaagccaagaattttaaaataagcacctgctttaaggccacagggagcaacacccaaggggttggagagcaatatgttgcccctgagccactggttggggatcactgttctaactaagggtataactgtgacacatctctaaccccaggtaattgcttctaatgttcctggtcgtaaataaaacactattttgattcaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGKDYYKILGIPKGATEEEIKKAYRKQALKYHPDKNKDPGAEDRFKEIAEAYDVLSDPKKREVFDKYGEEGLKGTPGGGGSSGGPNGTYSYTFHGDPHAVFAEFFGGRNPFDGFFGRNDDDMDTDDPFAGFGGMGGFGGMGGMGGMGGMGGMGGFPRSASGRRDTVPRKQDPPITRELPVSLEEVFNGCTKKMKISHKRLGPDGRSVRNEDKILTIQVKKGWKEGTKITFPKEGDETPSNIPADIVFVLKDKSHPVFKREGSDVVYTSKISLREALCGCSVNIPTVDNRTIPLTFTDIIRPGTKRRITNEGLPLPKSPDQRGDLIVEFDIRFPERLTASSREVLERVLPA
Donor tissue: gastrula