ORFeome > dpf2 – XORFeome 2.0

dpf2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis D4, zinc and double PHD fingers family 2, mRNA (cDNA clone MGC:88966 IMAGE:7003480), complete cds
Gene Symbol: dpf2
Gene ID: 448243
ORF gb_acc: MG134012
ORF ID: 11618

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075306

Library Location

Plate ID: GDExt11016
Well Location: D03

EST Sequences

Clone: MGC:88966 IMAGE:7003480
Trimmed Sequence: ATGACTACATATTTTAGTACAAATTACCACAAAAATCGAAGCTCTCATTTAAGTGAGCAATATTACAGAGAAGTTATGGACAGTACATCTAATTACAATGTTCGTCTTTGCTCTGAGCGACGGCAGAGACTCCCATTTCTTGATTCTCAAACTGGGGTTGCTCAAAATCACAGCAACCTCTGGGTGCCCTACACATATCGTAGACCAGGTAAATGCCATGGACAGTTATATTCTTACCCAGCTCGTCGCTGGAAAAAGAAATGTAGTCTCCCACTTCCAGATATTCCACTTGGACCACTGACTAGGATCAAACCAGCGGAATTGGAAGCTATCGAGTCAGATGTTCACCAGATAAGCACCGTCGAGAATCCGTCGATCGTAGCAGATAATGATTCAAAAGACCTTCCTTACGAAGAAGTGTCGTACAGGGAAGAATATTATAACGAATGGGAAAATTTGAGTGAACCTCCAGATGCGGGAGAGATCGATCGAAGGAATTCAGACAGCAGTGACTTTGAAGAGACTTATATTAAAAAGAAAGGAAAGAAGAAGGAAAAGAAGGTGGGCCTGCCCAAAGAACTCGTCAACAAGAACAGCCAGCGAACCATTGCAAGTTCTAAAACAACACCTTCCACTAATCGCGGCAGAAGTAAGAAAGAAAAAGAAATGGAGATTTTGTCCGACAAGGACAAGCCATATGCATGCGATCTGTGTGGAGCCCGATACAAGACTCGACCTGGGCTGACCTACCACATGGCCCACTCGCACAACAAACAGCCACCGGATGAAGAGATTGAATTGCCTCAGCCATCGCCGAAGATTGTTGTTCCACCGCCACCATTCGAAACTACAACCACTAGTTCAGGGTCGACTTTAGCCATCATTAAGAAGCCCCCATCAACGTCATCATCATCAAAATCTGGAAGCAAATATTGCGACTTTTGTCTCGGTGACGAACTCGAAAACAAGAAGACGGGGAGCAAGGAGGAGATGGTATCTTGTGCCGACTGCGGCCGATCTGGTCACCCAAGTTGTCTCCAGTTTTCACCCAACATGATAATCTCCGTCAAGAAATATCCCTGGCAGTGCATCGAGTGCAAGTCGTGCGGGCTTTGTGGAACATCGGACAACGACGATCAGTTATTGTTTTGTGACGATTGTGATCGCGGTTATCATATGTACTGCCTGAAACCACCACTCTCCGAGCCTCCCGAAGGAAGTTGGAGTTGCCACCTGTGTATAGTGGAGTTCTACGATGGACGCAAACCAGATACCATGGTTGAATGA
Full Trace Sequence: ctttgttgttgacgcatttttgttgttaatatgaaatattaatatttgcaaatatgactacatattttagtacaaattaccacaaaaatcgaagctctcatttaagtgagcaatattacagagaagttatggacagtacatctaattacaatgttcgtctttgctctgagcgacggcagagactcccatttcttgattctcaaactggggttgctcaaaatcacagcaacctctgggtgccctacacatatcgtagaccaggtaaatgccatggacagttatattcttacccagctcgtcgctggaaaaagaaatgtagtctcccacttccagatattccacttggaccactgactaggatcaaaccagcggaattggaagctatcgagtcagatgttcaccagataagcaccgtcgagaatccgtcgatcgtagcagataatgattcaaaagaccttccttacgaagaagtgtcgtacagggaagaatattataacgaatgggaaaatttgagtgaacctccagatgcgggagagatcgatcgaaggaattcagacagcagtgactttgaagagacttatattaaaaagaaaggaaagaagaaggaaaagaaggtgggcctgcccaaagaactcgtcaacaagaacagccagcgaaccattgcaagttctaaaacaacaccttccactaatcgcggcagaagtaagaaagaaaaagaaatggagattttgtccgacaaggacaagccatatgcatgcgatctgtgtggagcccgatacaagactcgacctgggctgacctaccacatggcccactcgcacaacaaacagccaccggatgaagagattgaattgcctcagccatcgccgaagattgttgttccaccgccaccattcgaaactacaaccactagttcagggtcgactttagccatcattaagaagcccccatcaacgtcatcatcatcaaaatctggaagcaaatattgcgacttttgtctcggtgacgaactcgaaaacaagaagacggggagcaaggaggagatggtatcttgtgccgactgcggccgatctggtcacccaagttgtctccagttttcacccaacatgataatctccgtcaagaaatatccctggcagtgcatcgagtgcaagtcgtgcgggctttgtggaacatcggacaacgacgatcagttattgttttgtgacgattgtgatcgcggttatcatatgtactgcctgaaaccaccactctccgagcctcccgaaggaagttggagttgccacctgtgtatagtggagttctacgatggacgcaaaccagataccatggttgaatgaatcttcaagagagccatgccatgccgatcgtggaatccccagataaccatgctgatcgaaaaatctccggataaccctgccggttggaaaatcaccgagaatccccagagaactatgccattcagagaactattcgaatcggaaaatgcccagaaactattccgattggaaaaacccctatgctaatcggagaatccccagaaagctatgccgattggagaatcctctatcggattcttatgtttattgactgtattggcaacaaatgatacttttatttgtagtctctgttaactcagtgttggtgtctgttcccagtatatatttatatttccagaagaattatcttaagtcgactgaatgcaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MTTYFSTNYHKNRSSHLSEQYYREVMDSTSNYNVRLCSERRQRLPFLDSQTGVAQNHSNLWVPYTYRRPGKCHGQLYSYPARRWKKKCSLPLPDIPLGPLTRIKPAELEAIESDVHQISTVENPSIVADNDSKDLPYEEVSYREEYYNEWENLSEPPDAGEIDRRNSDSSDFEETYIKKKGKKKEKKVGLPKELVNKNSQRTIASSKTTPSTNRGRSKKEKEMEILSDKDKPYACDLCGARYKTRPGLTYHMAHSHNKQPPDEEIELPQPSPKIVVPPPPFETTTTSSGSTLAIIKKPPSTSSSSKSGSKYCDFCLGDELENKKTGSKEEMVSCADCGRSGHPSCLQFSPNMIISVKKYPWQCIECKSCGLCGTSDNDDQLLFCDDCDRGYHMYCLKPPLSEPPEGSWSCHLCIVEFYDGRKPDTMVE
Donor tissue: