ORFeome > e2f3 – XORFeome 2.0

e2f3 – XORFeome 2.0

General Information

Species: Xenopus tropicalis E2F transcription factor 3, mRNA (cDNA clone MGC:89625 IMAGE:6995525), complete cds
Gene Symbol: e2f3
Gene ID: 496522
ORF gb_acc: MG134312
ORF ID: 11990

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC084507

Library Location

Plate ID: GDExt11019
Well Location: G09

EST Sequences

Clone: MGC:89625 IMAGE:6995525
Trimmed Sequence: ATGAGAAAGGGAACACAGGGCGGGCATGAGAAGCTGCTGCTTCCCGGTCTGCAGGGCACGGACAAGGGTTCCGGTCTGGCGGGGGGGTTCATCGCCGGGGGAGGAGGTGTCGTTGGCGCAGGAGGCGGCGGATACGTTCAGATCATTTCTTCCCCCGGTCCCCCGCTACATCACCACGGACTGTGTATCCCCGAGCAAGCGGCCAGTTTTATCTACTCCACCCCTCACGGACCCGCCACCAGAGCCGGCCAGCTCCAACCAGCACTGGGGCGCCCACCGGCAAAGAGACGACTGGAACTTGGTGATGGCAGTCATCAGTATCTCTCCGATGGGCTGAAGACACCCAAAGGCAAAGGAAGGGCAGTCACGCATTGTCCAGATAGCCCCAAGACTCCAAAGTCTCCCTTGGAAAAAACCCGGTATGACACCTCCCTTGGTCTCCTGACAAAGAAGTTTATTCAGCTGCTCAGCCAGTCTTCTGATGGTGTTGTGGATTTAAACAGAGCCGCTGAAGTCCTGAAGGTGCAGAAAAGAAGAATTTATGATATCACAAATGTACTAGAAGGAATTCACCTCATTAAAAAGAAATCAAAGAACAACATACAGTGGATGGGCTGTACTTTACCTGATGATGGAGGCAACTTGGCAAAATCTCAGGAACTTTCTAAGGAACTCTCAGAACTTGCTCAAGAGGAGAATAAACTAGATGAGTTAATAAAAAACTGTACTCTAGATCTAAAACACTTAACAGAAAATGCAGAGAATCAAAGATTAGCTTATGTAACATATCAAGATATACGCAAAATAAGTGGCCTTAAGGAACAAACTGTTATTGTGATAAGAGCCCCTCCAGAAACAAGACTTGAAGTGCCTGATCCTGTTGAGAGTTTGCAGATACATTTGTCCAGCAGCCAAGGAGCAATTGAGGTGTACCTGTGTCCTGAAGAGAGTGAATCCAGCAGCCCAGTAAAGCAGTGTAATCAAGATCACAATGGAAATGTATCCAAGCCCAAACCACACTCCAAAGATTCACTGTCGCCTAATATGGAAAATGTGAATTGCTCTGTGGAAGGGATCTCCCCTTTAACCTCTCCAACCAACCTCCTTCAGCAGACAGAAGATCAAATTTCTTTAAATATGGATGCCCCTTTTGTAAACTTGCTTCCTCCTCTCATGCAAGAAGATTATCTTTTAAGTCTTGGTGATGAAGAAGGCATCAGTGATCTATTTGATGCTTATGAGTTAGAAAAGCTGCCATCTTTGGATGACTTTATGTGCAGTTGA
Full Trace Sequence: ttcgcgcgtaaaccgcatcccttcattcattgtcagcttcctggagccatttttcagccgcggcagtggcggggcagtcgagccggggccctatcactctcagccgcacaatccacctccatctgcctcccccggtgcttgatacccctccggtgagcttgtcctatgcgtcctaaggtcctcctgtaacagcatccccggctatttccagcgcaaaggcccagaccggagcgaatttaggggatcggaaaaagggagagcgatcccggcccggggacaggagcggcgctggaggagagcgggggacactagtcaggaagatgagaaagggaacacagggcgggcatgagaagctgctgcttcccggtctgcagggcacggacaagggttccggtctggcgggggggttcatcgccgggggaggaggtgtcgttggcgcaggaggcggcggatacgttcagatcatttcttcccccggtcccccgctacatcaccacggactgtgtatccccgagcaagcggccagttttatctactccacccctcacggacccgccaccagagccggccagctccaaccagcactggggcgcccaccggcaaagagacgactggaacttggtgatggcagtcatcagtatctctccgatgggctgaagacacccaaaggcaaaggaagggcagtcacgcattgtccagatagccccaagactccaaagtctcccttggaaaaaacccggtatgacacctcccttggtctcctgacaaagaagtttattcagctgctcagccagtcttctgatggtgttgtggatttaaacagagccgctgaagtcctgaaggtgcagaaaagaagaatttatgatatcacaaatgtactagaaggaattcacctcattaaaaagaaatcaaagaacaacatacagtggatgggctgtactttacctgatgatggaggcaacttggcaaaatctcaggaactttctaaggaactctcagaacttgctcaagaggagaataaactagatgagttaataaaaaactgtactctagatctaaaacacttaacagaaaatgcagagaatcaaagattagcttatgtaacatatcaagatatacgcaaaataagtggccttaaggaacaaactgttattgtgataagagcccctccagaaacaagacttgaagtgcctgatcctgttgagagtttgcagatacatttgtccagcagccaaggagcaattgaggtgtacctgtgtcctgaagagagtgaatccagcagcccagtaaagcagtgtaatcaagatcacaatggaaatgtatccaagcccaaaccacactccaaagattcactgtcgcctaatatggaaaatgtgaattgctctgtggaagggatctcccctttaacctctccaaccaacctccttcagcagacagaagatcaaatttctttaaatatggatgccccttttgtaaacttgcttcctcctctcatgcaagaagattatcttttaagtcttggtgatgaagaaggcatcagtgatctatttgatgcttatgagttagaaaagctgccatctttggatgactttatgtgcagttgattgccacactaatgaatcccttttacttgaacacatatgatgaacttgttctgtttttctcccttcccttctgtttgcaatgaaactggaatttcttgctgataaccacaccaacacctctcctgagccatcccaacaagccatcaagaagaatgagtatctgtattgaaataaaattgaatttgctgcttcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MRKGTQGGHEKLLLPGLQGTDKGSGLAGGFIAGGGGVVGAGGGGYVQIISSPGPPLHHHGLCIPEQAASFIYSTPHGPATRAGQLQPALGRPPAKRRLELGDGSHQYLSDGLKTPKGKGRAVTHCPDSPKTPKSPLEKTRYDTSLGLLTKKFIQLLSQSSDGVVDLNRAAEVLKVQKRRIYDITNVLEGIHLIKKKSKNNIQWMGCTLPDDGGNLAKSQELSKELSELAQEENKLDELIKNCTLDLKHLTENAENQRLAYVTYQDIRKISGLKEQTVIVIRAPPETRLEVPDPVESLQIHLSSSQGAIEVYLCPEESESSSPVKQCNQDHNGNVSKPKPHSKDSLSPNMENVNCSVEGISPLTSPTNLLQQTEDQISLNMDAPFVNLLPPLMQEDYLLSLGDEEGISDLFDAYELEKLPSLDDFMCS
Donor tissue: neurula