ORFeome > ears2 – XORFeome 2.0

ears2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis glutamyl-tRNA synthetase 2, mitochondrial (putative), mRNA (cDNA clone MGC:79577 IMAGE:6978834), complete cds
Gene Symbol: ears2
Gene ID: 493404
ORF gb_acc: MG133640
ORF ID: 11188

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080925

Library Location

Plate ID: GDExt11011
Well Location: F07

EST Sequences

Clone: MGC:79577 IMAGE:6978834
Trimmed Sequence: ATGCGTCCTGCCTTTATCCGGGGCAAATGGTTGTCCCGAACGCTGGAACTTGCCACCGGCCTGGGAAGGAGGACGTGCAGCTCTAGGGAGTCAGGGAGGGAGGTGCGTGTCAGATTTGCACCCAGTCCCACTGGGTTTCTGCACCTAGGGGGCTTGCGCACAGCACTCTATAACTACTTGTTTGCCAAGAAACATGGAGGGGCTTTTATCCTGCGCCTTGAAGACACGGACAGGAGCCGGCTGGTCCCTGGGGCAGCTGAAAGCATTGAGGACATGCTGGAATGGGCAGGTATCCCACCAGATGAGAGTCCGAGGCACGGCGGGCCCTGTGGTCCTTATGAGCAGTCGAAGCGCCTTGATCTCTACCATGTGGCGGCACAAGCACTGCTAGACAGTGGGGCAGCATATCGTTGCTTCTGTACCCCACAAAGACTGGAGCTGCTGAAAAGAGAAGCGATGCGAAACAGGCAGACGCCACGCTATGACAACCGCTGCCGGCATTTGACTCCCAAACAAGTGGAGGAGAAGCTGTCCCGCAATTCCCCCTTTGTTATCCGTTTCTTTCTGCAAGAGGGCGCCCAGCCCTTTCAGGATCTCGTATACGGCTGGACTCAGCATGATGTGGCCAGTGTGGAGGGCGACCCAGTGATTCTAAAAGGAGATGGTTTCCCCACCTACCATCTAGCTAATGTAGTGGACGATCACCATATGTGCGTGAGTCATGTGCTCAGGGGAGCGGAGTGGCTGATTTCCACAGCCAAACACCTACTCTTGTATCAAGCCCTGGGCTGGCAGCCACCACAGTTTGCTCATCTCCCTTTATTGCTTAACAAGGACGGCTCCAAACTTTCTAAACGACAAGGGGATATCTTTATCCAGCATTATGTGCACAGTGGTTACCTCTCTGATGCCCTTCTGGACCTCATCACCAACTGCGGTTCAGGATTTACTGAAAACCAGATGGGTCGTACTGTTGACACCCTGATCCAGCAATATGAACTGGGCAAAACCAGCACCCATTCTGCGCTGTTGGATTTGGACAAGCTCCCAGAGTTTAACAGAATTCACCTCACCAGGTGGATTGAAGGCACAGAAACCCGAGTTCAGCTGGTCGGACAACTCCAGGTCCTGCTAAAGGACACATATAAAGATCTAGAGTTGGATGAAAAGCACATTGAGCGGATATTATTGCTTAGAAAGGGGCACTTGTGTCGGCTGACGGACCTGCTGTCCCCTGAATATTCCTACCTGTGGGTCAGGCCTTCGGTGACAAGGGAACAGCTGCAGTGCCTCACAAGTGAAGCCAGTAAGGTCAAGAACCTTGTAGTGAGGCTCCTGCAAGAGAATGACAGTGGCTTCACCCTGGAAACATTAAATGGGGAACTGAGGAAGCAGCTGAAACAAGTGAAAGACACAAAGTACAGCAGCGCTATGAAACTGCTCCGCGTGGCTCTGAGTGGCCAGGAGCACGGGCCAAGTGTTGCTGAAATGCTGCTCTCCCTGGGACGGCAGGAATCTATTGTCCGGCTGCAGAACGCTCTCCCTGACTGA
Full Trace Sequence: ggacgggcagtgtagcgcagggatatgcgtcctgcctttatccggggcaaatggttgtcccgaacgctggaacttgccaccggcctgggaaggaggacgtgcagctctagggagtcagggagggaggtgcgtgtcagatttgcacccagtcccactgggtttctgcacctagggggcttgcgcacagcactctataactacttgtttgccaagaaacatggaggggcttttatcctgcgccttgaagacacggacaggagccggctggtccctggggcagctgaaagcattgaggacatgctggaatgggcaggtatcccaccagatgagagtccgaggcacggcgggccctgtggtccttatgagcagtcgaagcgccttgatctctaccatgtggcggcacaagcactgctagacagtggggcagcatatcgttgcttctgtaccccacaaagactggagctgctgaaaagagaagcgatgcgaaacaggcagacgccacgctatgacaaccgctgccggcatttgactcccaaacaagtggaggagaagctgtcccgcaattccccctttgttatccgtttctttctgcaagagggcgcccagccctttcaggatctcgtatacggctggactcagcatgatgtggccagtgtggagggcgacccagtgattctaaaaggagatggtttccccacctaccatctagctaatgtagtggacgatcaccatatgtgcgtgagtcatgtgctcaggggagcggagtggctgatttccacagccaaacacctactcttgtatcaagccctgggctggcagccaccacagtttgctcatctccctttattgcttaacaaggacggctccaaactttctaaacgacaaggggatatctttatccagcattatgtgcacagtggttacctctctgatgcccttctggacctcatcaccaactgcggttcaggatttactgaaaaccagatgggtcgtactgttgacaccctgatccagcaatatgaactgggcaaaaccagcacccattctgcgctgttggatttggacaagctcccagagtttaacagaattcacctcaccaggtggattgaaggcacagaaacccgagttcagctggtcggacaactccaggtcctgctaaaggacacatataaagatctagagttggatgaaaagcacattgagcggatattattgcttagaaaggggcacttgtgtcggctgacggacctgctgtcccctgaatattcctacctgtgggtcaggccttcggtgacaagggaacagctgcagtgcctcacaagtgaagccagtaaggtcaagaaccttgtagtgaggctcctgcaagagaatgacagtggcttcaccctggaaacattaaatggggaactgaggaagcagctgaaacaagtgaaagacacaaagtacagcagcgctatgaaactgctccgcgtggctctgagtggccaggagcacgggccaagtgttgctgaaatgctgctctccctgggacggcaggaatctattgtccggctgcagaacgctctccctgactgaagacttctcgctgttcctgtgacagagtagcaccttaataaatgtattttgataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MRPAFIRGKWLSRTLELATGLGRRTCSSRESGREVRVRFAPSPTGFLHLGGLRTALYNYLFAKKHGGAFILRLEDTDRSRLVPGAAESIEDMLEWAGIPPDESPRHGGPCGPYEQSKRLDLYHVAAQALLDSGAAYRCFCTPQRLELLKREAMRNRQTPRYDNRCRHLTPKQVEEKLSRNSPFVIRFFLQEGAQPFQDLVYGWTQHDVASVEGDPVILKGDGFPTYHLANVVDDHHMCVSHVLRGAEWLISTAKHLLLYQALGWQPPQFAHLPLLLNKDGSKLSKRQGDIFIQHYVHSGYLSDALLDLITNCGSGFTENQMGRTVDTLIQQYELGKTSTHSALLDLDKLPEFNRIHLTRWIEGTETRVQLVGQLQVLLKDTYKDLELDEKHIERILLLRKGHLCRLTDLLSPEYSYLWVRPSVTREQLQCLTSEASKVKNLVVRLLQENDSGFTLETLNGELRKQLKQVKDTKYSSAMKLLRVALSGQEHGPSVAEMLLSLGRQESIVRLQNALPD
Donor tissue: tailbud