ORFeome > ela2 – XORFeome 2.0

ela2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis elastase 2, neutrophil, mRNA (cDNA clone MGC:89201 IMAGE:7017067), complete cds
Gene Symbol: ela2
Gene ID: 448597
ORF gb_acc: MG134171
ORF ID: 11807

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076933

Library Location

Plate ID: GDExt11018
Well Location: D07

EST Sequences

Clone: MGC:89201 IMAGE:7017067
Trimmed Sequence: ATGGAGCATCACCTGCTTGTTACATTGTCAATTTTGTGGGCAAGCCAAGTAAATGGTGGTTCCATGCATACTCAGATTGTGGGTGGCAGAGAGGCAACCCCAAACTCTCATCCATACATAGCTTCATTGCAGTTGAGAGGCCGGCATTTTTGTGGGGGGTCCCTGATTGCCCCACAGTTTCTCATGACTGCTGCTCATTGTATGGAGAATACTGCATCCAACTTGGTGACAGTGGTGTTGGGGGCTCACTCCCTTCGAGCTAATGAGGCAACCAAGCAAAGGTTTAGGGTTAACCAAGTCTTTGAAAATGGCTTCAATCCTCTGACTTTGCAAAACGACATTGTCATACTAAAACTCGATCGACCAGTGAGTCTAAATGGAAAAGTACAGGTGGTGTCTCTGCCTAGTGCCAATGAGGATGTCCCTGCAGGGACTCAGTGTGTGACTGCTGGGTGGGGCCGACTTTCCACAGAAGGACAAATACCTGACCGTCTTCAGGAACTTAATGTCACTGTAACTAGACAAAACTTGTGCCGCCCCAATAACATCTGCACAGGGGTCTTCATGCAACAGGCTGGCATCTGCTTTGGTGACTCTGGTGGCCCTCTTGTGTGTAATGGTGTGATCCAGGGAATCACTTCCTTTATTATCCGCAGTTGTGGGAATGGCGTGACTCCTGATTTCTTCTCAAGGGTTTCTCTTTTCCGGAGGTTCATTGACGATGCAATTAACAGCTGA
Full Trace Sequence: aaaatggagcatcacctgcttgttacattgtcaattttgtgggcaagccaagtaaatggtggttccatgcatactcagattgtgggtggcagagaggcaaccccaaactctcatccatacatagcttcattgcagttgagaggccggcatttttgtggggggtccctgattgccccacagtttctcatgactgctgctcattgtatggagaatactgcatccaacttggtgacagtggtgttgggggctcactcccttcgagctaatgaggcaaccaagcaaaggtttagggttaaccaagtctttgaaaatggcttcaatcctctgactttgcaaaacgacattgtcatactaaaactcgatcgaccagtgagtctaaatggaaaagtacaggtggtgtctctgcctagtgccaatgaggatgtccctgcagggactcagtgtgtgactgctgggtggggccgactttccacagaaggacaaatacctgaccgtcttcaggaacttaatgtcactgtaactagacaaaacttgtgccgccccaataacatctgcacaggggtcttcatgcaacaggctggcatctgctttggtgactctggtggccctcttgtgtgtaatggtgtgatccagggaatcacttcctttattatccgcagttgtgggaatggcgtgactcctgatttcttctcaagggtttctcttttccggaggttcattgacgatgcaattaacagctgaattatgcatatccttttccccagcccactcacacttatgcatatccttctcccctgacccaacttacactctttctagtttactaatcagattacttaactgcagaaataagaaaaggttaatgtcccaggtttagaattgcttcatgctcagctaatggaggatgcttggaaagcttcttatcattgtgctcccataccttctgtttccatacctccagtcacaatagctgatctacgttatgctccatgtattaggctattacccatgtgtgatatctcagcttaacctgtattttatgtgttctgcatgggattatgctcagggtaagctagtgatccccaaccaggggctcgtgggcaacatgttgatcaccatcccctttgattttgctcccagtggcctcaaagtaggtgcatatttttaaatttctggcatggaggcaagttttggaagcccatagacaccgttttacatcaagcagaacctcctgcaggctagcagtccacatttgtctaccaaatacccaatcacagtgcatccccaaagaattcttttcatgcttgtgtggctcagcaaaccttttaaatgtgagtgtgggtcacaacttaaaaaaagttggagatccctgttgtgagctataaccaagatttggaaagaacagtcataagcaaaagctaacccttcagatattttaaactacaatacccaggtattttggcattgcagtctttaggaaaccttttcctgccagtacagtgctctttgccactcttgtatttagcagccatagtgcaccacggccaccataaatggcatgcctaatgagcatgacttatattaagaaatcagattctaacaaatgaaacttttgttactgtcaaatgtgctcacagtgtatactgtatatgattgcaagttaataaactataccattctataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MEHHLLVTLSILWASQVNGGSMHTQIVGGREATPNSHPYIASLQLRGRHFCGGSLIAPQFLMTAAHCMENTASNLVTVVLGAHSLRANEATKQRFRVNQVFENGFNPLTLQNDIVILKLDRPVSLNGKVQVVSLPSANEDVPAGTQCVTAGWGRLSTEGQIPDRLQELNVTVTRQNLCRPNNICTGVFMQQAGICFGDSGGPLVCNGVIQGITSFIIRSCGNGVTPDFFSRVSLFRRFIDDAINS
Donor tissue: