ORFeome > epc2 – XORFeome 2.0

epc2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis enhancer of polycomb homolog 2, mRNA (cDNA clone MGC:79646 IMAGE:6980172), complete cds
Gene Symbol: epc2
Gene ID: 448185
ORF gb_acc: MG133738
ORF ID: 11306

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075105

Library Location

Plate ID: GDExt11012
Well Location: C05

EST Sequences

Clone: MGC:79646 IMAGE:6980172
Trimmed Sequence: ATGAGCAAACTCTCCTTCCGAGCGCGGGCGCTAGACGCCGCCAAACCTCTCCCTATCTACCGCGGCAAAGACATGCCCGACCTCAATGACTGCGTCTCTATCAACCGGGCCGTGCCGCAGATGCCGACGGGGATGGAAAAGGAGGAGGAATCGGAACATCACTTACAGCGAGCAATCTCAGCACAACAAGTTTTCAGAGAGAAGAAAGAGAGCATGGTCATTCCGGTTCCTGAGGCCGAGAGCAATGTTCACTACTACAGTCGTCTGTACAAAGGGGAATTTAAACAGCCCAAGCAGTTCATTCACATCCAGCCTTTTAATCTGGACTATGAGCAGCCAGATTATGATATGGACTCTGAAGACGAGACGTTGCTTAACCGACTGAACAGGAAAATGGAAATCAAGCCACTGCAATTTGAAATTATGATTGACAGGCTGGAAAAGGCAAGCTCAAATCAGCTTGTTACTCTTCAGGAAGCTAAGCTGCTGCTAAATGAAGATGATTACCTTATCAAATCTGTATATGACTACTGGGTAAGAAAACGGAAGAACTGCAGGGGGCCCTCCCTCATTCCTCAAGTCAAGCAAGAAAAAAGAGATGGTTCTACAAATAATGACCCCTATGTTGCTTTTCGACGAAGAACAGAGAAAATGCAAACTCGAAAGAACCGAAAGAATGATGAAGTCTCTTATGAGAAAATGTTAAAGTTAAGAAGGGAGTTTAGCCGAGCCATAACCATTTTGGAAATGATCAAAAGGAGAGAAAAGACAAAGCGGGAGTTGTTGCACTTAACGTTGGAAGTGGTTGAGAAAAGGTATAATCTGGGTGACTTTGGAGGTGAAATACTAAATGAAATAAAGATTCCAAAGGTTGAGAAGGAGATCCATGTCATCCCACCATCTCTGCATAATGGAAACCATCACAAAGTACCAGAATGCAAAGTCAAGAACACCCACCACCCCTCCGTAAAAGACGAAGTCTTAGAAATCGTTCGCCTGAAAAAGAAGTATCCAAAGAAGCCAAAAGCAGAAACCCTTGTAACCCCTCAACCCCAAGCCACCTCAGAGCCATTGGCAGTAATAAACAAGAGTGATATCAAACAATATGACTTCCAAAGCTCCGATGATGACGAATTCCCACAGGTACCCTCTCCACTGTCAGAGCTTGAGGAAGAGAATGACCCCGATGGATCTTATGCTTTCAGAAGGAGAACTGGATGCCAGTATTATGCACCTCGTTTGGACCAAATGAATGATACTCCGGAAACCACAGACTTATCGGGATTAGCAAGGCATCGGTATAGGCATTGTCTCACAACCCTCACAGTCCCCAGGCGATGTATAGGATTTGCCAGGAAGCGATTAGGCAGAGGCGGAAGGGTAATAATGGACCGACTATCGACAGAACACGACTCCATTCTCAAGCAAATTGACCCTGAAATGTTATCTGGCTTTTCAAGCTCTTCCCACGTTGCACAGCCCCCCTCCTCACCTTCACGGACCAATGCTTCCGATAGACATTGTGAAAACAGACTTTCTCTTCCCGAGATCTTAAGCAATATTAAATCTTGTCGACTGCAGTGTTTTCAGCCAAGGCTACTACATACACAGGACAGCGATAGAGAAGAATGTACCTCAAGGCTAGGGCAAGCTGTGAACGTGAAAAGAGTCTCTGCCGCTTTATTAAACACCAGCAAGAACGGCATAACAGTGACAGGAGGCATCACAGAGGAACAGTTCCAGACACACCAACAGCAGCTGGTTCAGATGCAAAGGCAACAGCTGGCGCAGCTCCAGCAAAAACAGCAGTCGCAGCAATCCTTGCAGCAGAGCCATCCGAAAGCACAGGGCTCGGCCAAATCCGACTGCATGTCCAAGACGCTTGACTCAGCAAGTGCCCTTTTTGCTGCATCTGCTGTGGTCAATTCTCCAACTCCAGGCCGCAGTGAAGTGAACAAGGATCAAAATGCCGGTCATAGCAACCTGAATGGCGTTGTACAACCTTCAGGCACTGCTAAAACGCTGTACTCCACAAATATGGCTTTATCGTCCAGCCCAGGGATTTCCACCGTTCAGCTTGTAAGGACAGTTGGCCATCCTACCACTAACCACTTAATTCCAACATTGTGCACAAGCAACCCTCAGACCCTCACTATGGGTAACTCTTGCCTAGCTAACACAGTCCACCTCAACAATGTCAGTGTTGTCTCCCCTGTCAATGTGCATATCAATACAAGGACTTCTGCACCATCGCCAACAGCCTTAAAACTTGCCACAGTTGCTGCCAGCATGGACAGAGTGCCAAAGGTTACTCCTAGCAGTGCCATCAGCAGTATAGCAAGAGAAAACCATGAACCAGAAAGATTGGGTTTAAACGGAATCGCCGACACCACAGTGGCTATGGAAGTGACATAA
Full Trace Sequence: gtccgccatgtttgccatggcgcagggagcggatcgagccaacaaagcccggatctaggaacgaggaggcgccgcccgagccgccgcattccgccccttctcgcaccccggggtccccatgagtccacaggggacgttaccgtgcggctccggctggtctttctgactgagatttttacgtgttttttttgttgttcctcccccctcccctgcgcgtcgggtgtttgtgtgagacaatgagcaaactctccttccgagcgcgggcgctagacgccgccaaacctctccctatctaccgcggcaaagacatgcccgacctcaatgactgcgtctctatcaaccgggccgtgccgcagatgccgacggggatggaaaaggaggaggaatcggaacatcacttacagcgagcaatctcagcacaacaagttttcagagagaagaaagagagcatggtcattccggttcctgaggccgagagcaatgttcactactacagtcgtctgtacaaaggggaatttaaacagcccaagcagttcattcacatccagccttttaatctggactatgagcagccagattatgatatggactctgaagacgagacgttgcttaaccgactgaacaggaaaatggaaatcaagccactgcaatttgaaattatgattgacaggctggaaaaggcaagctcaaatcagcttgttactcttcaggaagctaagctgctgctaaatgaagatgattaccttatcaaatctgtatatgactactgggtaagaaaacggaagaactgcagggggccctccctcattcctcaagtcaagcaagaaaaaagagatggttctacaaataatgacccctatgttgcttttcgacgaagaacagagaaaatgcaaactcgaaagaaccgaaagaatgatgaagtctcttatgagaaaatgttaaagttaagaagggagtttagccgagccataaccattttggaaatgatcaaaaggagagaaaagacaaagcgggagttgttgcacttaacgttggaagtggttgagaaaaggtataatctgggtgactttggaggtgaaatactaaatgaaataaagattccaaaggttgagaaggagatccatgtcatcccaccatctctgcataatggaaaccatcacaaagtaccagaatgcaaagtcaagaacacccaccacccctccgtaaaagacgaagtcttagaaatcgttcgcctgaaaaagaagtatccaaagaagccaaaagcagaaacccttgtaacccctcaaccccaagccacctcagagccattggcagtaataaacaagagtgatatcaaacaatatgacttccaaagctccgatgatgacgaattcccacaggtaccctctccactgtcagagcttgaggaagagaatgaccccgatggatcttatgctttcagaaggagaactggatgccagtattatgcacctcgtttggaccaaatgaatgatactccggaaaccacagacttatcgggattagcaaggcatcggtataggcattgtctcacaaccctcacagtccccaggcgatgtataggatttgccaggaagcgattaggcagaggcggaagggtaataatggaccgactatcgacagaacacgactccattctcaagcaaattgaccctgaaatgttatctggcttttcaagctcttcccacgttgcacagcccccctcctcaccttcacggaccaatgcttccgatagacattgtgaaaacagactttctcttcccgagatcttaagcaatattaaatcttgtcgactgcagtgttttcagccaaggctactacatacacaggacagcgatagagaagaatgtacctcaaggctagggcaagctgtgaacgtgaaaagagtctctgccgctttattaaacaccagcaagaacggcataacagtgacaggaggcatcacagaggaacagttccagacacaccaacagcagctggttcagatgcaaaggcaacagctggcgcagctccagcaaaaacagcagtcgcagcaatccttgcagcagagccatccgaaagcacagggctcggccaaatccgactgcatgtccaagacgcttgactcagcaagtgccctttttgctgcatctgctgtggtcaattctccaactccaggccgcagtgaagtgaacaaggatcaaaatgccggtcatagcaacctgaatggcgttgtacaaccttcaggcactgctaaaacgctgtactccacaaatatggctttatcgtccagcccagggatttccaccgttcagcttgtaaggacagttggccatcctaccactaaccacttaattccaacattgtgcacaagcaaccctcagaccctcactatgggtaactcttgcctagctaacacagtccacctcaacaatgtcagtgttgtctcccctgtcaatgtgcatatcaatacaaggacttctgcaccatcgccaacagccttaaaacttgccacagttgctgccagcatggacagagtgccaaaggttactcctagcagtgccatcagcagtatagcaagagaaaaccatgaaccagaaagattgggtttaaacggaatcgccgacaccacagtggctatggaagtgacataactctcagcccacagactttgcctgacccttccaggcgtttgttttccaacaaaatgcaaattatatctaacgctctgcggatcacagtgcgctaatatggacctaaacggactgtccgcgtcatcggcccgttcctccgatcacgcccgtgtacattttgtaaaaaaaaaaattaaaaaaaaaaaatcaaaaaaaaaaaaaaaaaaaa
Translation: MSKLSFRARALDAAKPLPIYRGKDMPDLNDCVSINRAVPQMPTGMEKEEESEHHLQRAISAQQVFREKKESMVIPVPEAESNVHYYSRLYKGEFKQPKQFIHIQPFNLDYEQPDYDMDSEDETLLNRLNRKMEIKPLQFEIMIDRLEKASSNQLVTLQEAKLLLNEDDYLIKSVYDYWVRKRKNCRGPSLIPQVKQEKRDGSTNNDPYVAFRRRTEKMQTRKNRKNDEVSYEKMLKLRREFSRAITILEMIKRREKTKRELLHLTLEVVEKRYNLGDFGGEILNEIKIPKVEKEIHVIPPSLHNGNHHKVPECKVKNTHHPSVKDEVLEIVRLKKKYPKKPKAETLVTPQPQATSEPLAVINKSDIKQYDFQSSDDDEFPQVPSPLSELEEENDPDGSYAFRRRTGCQYYAPRLDQMNDTPETTDLSGLARHRYRHCLTTLTVPRRCIGFARKRLGRGGRVIMDRLSTEHDSILKQIDPEMLSGFSSSSHVAQPPSSPSRTNASDRHCENRLSLPEILSNIKSCRLQCFQPRLLHTQDSDREECTSRLGQAVNVKRVSAALLNTSKNGITVTGGITEEQFQTHQQQLVQMQRQQLAQLQQKQQSQQSLQQSHPKAQGSAKSDCMSKTLDSASALFAASAVVNSPTPGRSEVNKDQNAGHSNLNGVVQPSGTAKTLYSTNMALSSSPGISTVQLVRTVGHPTTNHLIPTLCTSNPQTLTMGNSCLANTVHLNNVSVVSPVNVHINTRTSAPSPTALKLATVAASMDRVPKVTPSSAISSIARENHEPERLGLNGIADTTVAMEVT
Donor tissue: tailbud