ORFeome > fbxl11 – XORFeome 2.0

fbxl11 – XORFeome 2.0

General Information

Species: Xenopus tropicalis F-box and leucine-rich repeat protein 11, mRNA (cDNA clone MGC:79647 IMAGE:6980178), complete cds
Gene Symbol: fbxl11
Gene ID: 496596
ORF gb_acc:
ORF ID: 11957

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC086264

Library Location

Plate ID: GDExt11019
Well Location: F01

EST Sequences

Clone: MGC:79647 IMAGE:6980178
Trimmed Sequence: ATGGAAGAGGAGCAACTCCGATACAGCCGCAGATTGAGGCATACACTGCGTCGCCGTTATGAAGATGATGGAATATCAGATGATGAGATTGAAGGAAAAAGAACTTTTGATTTGGAGGAAAAATTGAGAAGCAGCAAGTACAACTCCAACTTTATCACCTATATGGAGGGCAAAGATTTTAACATGAAATTTATTCAAGAAGGAGGACTCAGGGACCCAATCATTTTTACAAAATCTGAAGGACTTGGCATCAAAATGCCTGATCCTAACTTTAGTGTGAATGATGTCAAGATGTTTGTTGGGAGTAGGCGTGTTGTAGATGTTATGGACGTCGGGACTCAGAAGGGCATAGAAATGACAATGGCACAATGGGCAAAATACTACGAGACACCTGAAGAAGAGAGAGAAAAACTATATAATGTGATCAGCCTGGAGTTTAGCCACACTAAGCTGGAGAATCTGGTACAGAGGCCGACCACGGTGGATCAGATTGATTGGGTTGACAATATCTGGCCAAGGCATCTAAAGGACAGGCAGACTGAATCCACAAATGTAATTCAAGAGATGCAATATCCCAAAGTACAAAAGTACTGCCTCATGAGTGTTCGTGGTTGTTATACAGATTTTCATGTGGACTTTGGTGGCACATCCGTGTGGTACCACATACTCAGAGGAGGCAAGGTTTTTTGGCTAATACCTCCTACAGATCAAAATCTGGAACTATATGAGAATTGGCTGCTGTCGGGAAAACAAGGTGACGTCTTTCTTGGGGATAGGGTCACCGAGTGTCAGCGCATTGAACTAAAACAAGGCTACACATTTGTTATTCCCTCAGGATGGATTCATGCTGTGTACACACCTCAGGACACACTGGTGTTTGGTGGGAATTTCCTGCACAGCTTCAACATACCAATGCAACTTCGTATATACAGCATCGAGGACAGGACAAGGGTACCTACAAAGTTCCGATATCCATTTTATTATGAAATGTGTTGGTATGTGCTTGAACGATATGTCTACTGCATGATGCGACGCTCTCATCTCACAAAGGAGTTCCAAAGGGAGTCTCTGAGCATTGATTTAGAGCTTAACGGACGCCAGAGACCTGACACTCCATCCTCATCATCTTCATCATCCTCATCTGGATTATCGTCTTCCTCTGATAATGATGATTCCTCTGATCAAGATTGGGAGGAAGAGGAAGGTCTGAGAAAGAGGGAAAGAGATAGATGCAGAGTGGAGCGAGAACTTCAGAGGAAAAGGAACAGGGATAGGCAACAAAGAGACCAAGAAAGAGATCGACATGGGCGTACTGAGAGGATAATTATCCATACTCTACCTGCTTCCCTACGTCCTTTAACTCCACCACCTTCTCTTCCGCTGCCAACACCAGATTCACCTCCCAGCACCTCTCCCTTCCTGACATGGTTTGAAGTTGAAGGATTACGCTGTCTTGTGCTGAAACTTGAATCCCTGCCACCACTTAAAAAGTGCCTACCAGATGGTATCCATGACCCAGAAGCTCTTATCTTTGATATCAAGAGACTTCTTGAGGACCACGCTCATGATCCACCTGAGCTTGCGCTCACTGGCGTTCCAATAATTCAGTGGCCCAAGAGAAGTCAGTATAAGGTTCACCTTCGGCCCAAGATTCAGTTTACAAAACCTCACACCATGCGTCCAGCTTCCCGTCACTCCACAGCTCCTCCTCGGACGTCAGGCACTCCATCTGGTACTACAGCTTCTTCTGGAGCTCGAAGGCGCCGTGTCAGGTGTCGCAAGTGTCAAGCTTGTGTCCAGCGAGAGTGTGGGACTTGCCACTACTGTAAAGATATGAAGAAGTTTGGAGGGCCAGGCCGTATGAAACAGTCTTGTGTACTGAGGCAGTGCCTTGCGCCCAGACTGCCCCATTCGGTGACCTGTGCCTTGTGTGGTGAAGTGGATCAAACAAATGACACACAGGATTTTGAAAGAAAGCTGATGGAGTGTTCAGTTTGCAATGAGATTGTTCACCCAGGATGTCTAGAGATGGATGGTGAAGGACTGCTAAGTGATGAACTTCCGAACTACTGGGAGTGTCCCAAATGTTATGAGGGACAGAAGCACACGGTGGAGGCAAATCACGACCGCATCTTACTGCACAGTAAACGTAAAGCTGCTGACAACTACGAGAGCAGTCATTACTATCCTGCCAAAGTTCTTCGGCCTCCACTGGGTCAGAGCCCCCCATCCCCACCTCTTCTTTTGCTCCCACCCTCCCCTTCATCTGCTCCACCCACACCACCCTCTGCCCAAACACAAGTCCCACTTGCAAGCCGAGAAGAGCGAGCCAAGAGGCGCCAGCTTGCTAGAGAGAAAGAGAACCACCCAACTGGATGTGATCAGTCTGAGGGAGATCGTTTGAGGCTTAGGGGGCCCTATCTCACTGTCACTCTTCAGCGTCCACCAAAAGAATTAAGCTCCACTTCCATTGTTCCCAAGTTACAAGCCATCACACCTAATCCTCGACAGCCTATACGCGCAGCACCACTACATCAGGATGAGGAACGAGAAGAAGAAGAGGAGGAGGAGGAAGAAGAAGAAGAAACAGAGAATGTCATGCTAGGTCAAAGAAAAGACAGCACATCAATGCAGAAAGATGTTTGGCTTTCTGTTTTCCATTACCTCACACATGAAGAGCTTTGCATCTGTATGAGAGTCTGCAAAGCTTGGTACAAATGGGGCTGTGACAAACGTCTCTGGTCGAGGATTGATGTTAGTCGTTGTAAGTCTCTAGTACCACAGGCTCTCAGTGGCATTATAAAGCGACAGCCTATATACCTTGACTTGAGCTGGACAAATGTGTCAAAGAAGCAACTTATATGGCTTATCAACCGCTTGCCAGGTCTGAAGGACTTAATCCTTGCTGGTTGCACTTGGTCTGCTGTCTCTGCCCTTGCTAGCTGTAGTTGTCCCCTTCTGCGTACTCTGGACCTGCGCTGGACAGTTGGAATCAAAGATACTCAGATTAGAGATTTGCTTACACCAGCCTCGGACAAATCAGGACATGATTCTCGCAGCAAGCTACGCCTGCTAACAGATCTGCGCCTGTCTGGCCTTGATATTTCTGATGTTACTTTGAGGTTAATCATACGCCATTGCCCACTTCTGTCTAAGCTTGACCTTAGCCACTGTCCACTGCTTTCTGATCAGTCTGTAAACCTCCTTACAGCTGTAGGCTCTTCTACAAGGGGAACTCTCACTCACATACACTTAGCAGGTTGTAAAGGGGTAACAGACGAGTCTCTTCTATATCTGCGACGCGCCACTAATCTGTCCCTTATTGACTTGCATGGTTGCAAGCAGGTTACTCGGGGAGCTTGTGAGGAATTTATTTCAGACCTCTCTGTGAGCACCTTGTATTGTTTATCAGATGATAAACTCATCCAGAGGATCAGCTAG
Full Trace Sequence: ctgcgggacttttaaacagcgtttcttgactgtgggctgagttaaaaaatccagactgtcccaggaaaaccgggactgtcaggcgagtactgcaagccatagaattattgtgtgcagaccctataccctctccttgaatgttgagagactggaagaaatggaagaggagcaactccgatacagccgcagattgaggcatacactgcgtcgccgttatgaagatgatggaatatcagatgatgagattgaaggaaaaagaacttttgatttggaggaaaaattgagaagcagcaagtacaactccaactttatcacctatatggagggcaaagattttaacatgaaatttattcaagaaggaggactcagggacccaatcatttttacaaaatctgaaggacttggcatcaaaatgcctgatcctaactttagtgtgaatgatgtcaagatgtttgttgggagtaggcgtgttgtagatgttatggacgtcgggactcagaagggcatagaaatgacaatggcacaatgggcaaaatactacgagacacctgaagaagagagagaaaaactatataatgtgatcagcctggagtttagccacactaagctggagaatctggtacagaggccgaccacggtggatcagattgattgggttgacaatatctggccaaggcatctaaaggacaggcagactgaatccacaaatgtaattcaagagatgcaatatcccaaagtacaaaagtactgcctcatgagtgttcgtggttgttatacagattttcatgtggactttggtggcacatccgtgtggtaccacatactcagaggaggcaaggttttttggctaatacctcctacagatcaaaatctggaactatatgagaattggctgctgtcgggaaaacaaggtgacgtctttcttggggatagggtcaccgagtgtcagcgcattgaactaaaacaaggctacacatttgttattccctcaggatggattcatgctgtgtacacacctcaggacacactggtgtttggtgggaatttcctgcacagcttcaacataccaatgcaacttcgtatatacagcatcgaggacaggacaagggtacctacaaagttccgatatccattttattatgaaatgtgttggtatgtgcttgaacgatatgtctactgcatgatgcgacgctctcatctcacaaaggagttccaaagggagtctctgagcattgatttagagcttaacggacgccagagacctgacactccatcctcatcatcttcatcatcctcatctggattatcgtcttcctctgataatgatgattcctctgatcaagattgggaggaagaggaaggtctgagaaagagggaaagagatagatgcagagtggagcgagaacttcagaggaaaaggaacagggataggcaacaaagagaccaagaaagagatcgacatgggcgtactgagaggataattatccatactctacctgcttccctacgtcctttaactccaccaccttctcttccgctgccaacaccagattcacctcccagcacctctcccttcctgacatggtttgaagttgaaggattacgctgtcttgtgctgaaacttgaatccctgccaccacttaaaaagtgcctaccagatggtatccatgacccagaagctcttatctttgatatcaagagacttcttgaggaccacgctcatgatccacctgagcttgcgctcactggcgttccaataattcagtggcccaagagaagtcagtataaggttcaccttcggcccaagattcagtttacaaaacctcacaccatgcgtccagcttcccgtcactccacagctcctcctcggacgtcaggcactccatctggtactacagcttcttctggagctcgaaggcgccgtgtcaggtgtcgcaagtgtcaagcttgtgtccagcgagagtgtgggacttgccactactgtaaagatatgaagaagtttggagggccaggccgtatgaaacagtcttgtgtactgaggcagtgccttgcgcccagactgccccattcggtgacctgtgccttgtgtggtgaagtggatcaaacaaatgacacacaggattttgaaagaaagctgatggagtgttcagtttgcaatgagattgttcacccaggatgtctagagatggatggtgaaggactgctaagtgatgaacttccgaactactgggagtgtcccaaatgttatgagggacagaagcacacggtggaggcaaatcacgaccgcatcttactgcacagtaaacgtaaagctgctgacaactacgagagcagtcattactatcctgccaaagttcttcggcctccactgggtcagagccccccatccccacctcttcttttgctcccaccctccccttcatctgctccacccacaccaccctctgcccaaacacaagtcccacttgcaagccgagaagagcgagccaagaggcgccagcttgctagagagaaagagaaccacccaactggatgtgatcagtctgagggagatcgtttgaggcttagggggccctatctcactgtcactcttcagcgtccaccaaaagaattaagctccacttccattgttcccaagttacaagccatcacacctaatcctcgacagcctatacgcgcagcaccactacatcaggatgaggaacgagaagaagaagaggaggaggaggaagaagaagaagaaacagagaatgtcatgctaggtcaaagaaaagacagcacatcaatgcagaaagatgtttggctttctgttttccattacctcacacatgaagagctttgcatctgtatgagagtctgcaaagcttggtacaaatggggctgtgacaaacgtctctggtcgaggattgatgttagtcgttgtaagtctctagtaccacaggctctcagtggcattataaagcgacagcctatataccttgacttgagctggacaaatgtgtcaaagaagcaacttatatggcttatcaaccgcttgccaggtctgaaggacttaatccttgctggttgcacttggtctgctgtctctgcccttgctagctgtagttgtccccttctgcgtactctggacctgcgctggacagttggaatcaaagatactcagattagagatttgcttacaccagcctcggacaaatcaggacatgattctcgcagcaagctacgcctgctaacagatctgcgcctgtctggccttgatatttctgatgttactttgaggttaatcatacgccattgcccacttctgtctaagcttgaccttagccactgtccactgctttctgatcagtctgtaaacctccttacagctgtaggctcttctacaaggggaactctcactcacatacacttagcaggttgtaaaggggtaacagacgagtctcttctatatctgcgacgcgccactaatctgtcccttattgacttgcatggttgcaagcaggttactcggggagcttgtgaggaatttatttcagacctctctgtgagcaccttgtattgtttatcagatgataaactcatccagaggatcagctagagtgaaaggacctgttaaaaggaccggaagtagttatctgctttctcctgccactccataacatacaaagaaggagcaataattggtatctccacctacatcatttaccatctacagtgaaaccattgtttggtccaaggaagtgtgccattaaaacgggtatataactaactctggttgccctagtgccctaatagttggaggagcacttttttcccttaaatgctgacatcaatagaaccagattttcatctccacagagcaaagaacactctatttttcttactcttaatttttgcttagttcacactctccttaaggctggtcagcatggagagcaagggtggaggaaggttttgtttttgtttgttttgcttgttaggaatttgtgagagagaatgttctgctaatgttatatgggtgtctgatgagttgtgtgtttcattatattttggagaggaaggaggcagcttttgtgatagagttaatatttttttttattattattatttaattgaattgtagctttttttccattacctctcatacagagtacacacattcatttacccttaacagtaaatttatttcatgcaaccagtgcagccatgtgtggatatatacatatataaatatatataaatgccggtatggcacacagagtgttatgtgtgtcagtgccacttattttggcacaatcggctgtcctctcccttgaccctgggattagattgtataaaaaaagagcctggataatatttttctctgtggaggcgatctcgctttctctttatttcttttgcaataaaaaaaagtttatgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MEEEQLRYSRRLRHTLRRRYEDDGISDDEIEGKRTFDLEEKLRSSKYNSNFITYMEGKDFNMKFIQEGGLRDPIIFTKSEGLGIKMPDPNFSVNDVKMFVGSRRVVDVMDVGTQKGIEMTMAQWAKYYETPEEEREKLYNVISLEFSHTKLENLVQRPTTVDQIDWVDNIWPRHLKDRQTESTNVIQEMQYPKVQKYCLMSVRGCYTDFHVDFGGTSVWYHILRGGKVFWLIPPTDQNLELYENWLLSGKQGDVFLGDRVTECQRIELKQGYTFVIPSGWIHAVYTPQDTLVFGGNFLHSFNIPMQLRIYSIEDRTRVPTKFRYPFYYEMCWYVLERYVYCMMRRSHLTKEFQRESLSIDLELNGRQRPDTPSSSSSSSSSGLSSSSDNDDSSDQDWEEEEGLRKRERDRCRVERELQRKRNRDRQQRDQERDRHGRTERIIIHTLPASLRPLTPPPSLPLPTPDSPPSTSPFLTWFEVEGLRCLVLKLESLPPLKKCLPDGIHDPEALIFDIKRLLEDHAHDPPELALTGVPIIQWPKRSQYKVHLRPKIQFTKPHTMRPASRHSTAPPRTSGTPSGTTASSGARRRRVRCRKCQACVQRECGTCHYCKDMKKFGGPGRMKQSCVLRQCLAPRLPHSVTCALCGEVDQTNDTQDFERKLMECSVCNEIVHPGCLEMDGEGLLSDELPNYWECPKCYEGQKHTVEANHDRILLHSKRKAADNYESSHYYPAKVLRPPLGQSPPSPPLLLLPPSPSSAPPTPPSAQTQVPLASREERAKRRQLAREKENHPTGCDQSEGDRLRLRGPYLTVTLQRPPKELSSTSIVPKLQAITPNPRQPIRAAPLHQDEEREEEEEEEEEEEETENVMLGQRKDSTSMQKDVWLSVFHYLTHEELCICMRVCKAWYKWGCDKRLWSRIDVSRCKSLVPQALSGIIKRQPIYLDLSWTNVSKKQLIWLINRLPGLKDLILAGCTWSAVSALASCSCPLLRTLDLRWTVGIKDTQIRDLLTPASDKSGHDSRSKLRLLTDLRLSGLDISDVTLRLIIRHCPLLSKLDLSHCPLLSDQSVNLLTAVGSSTRGTLTHIHLAGCKGVTDESLLYLRRATNLSLIDLHGCKQVTRGACEEFISDLSVSTLYCLSDDKLIQRIS
Donor tissue: tailbud