ORFeome > flcn – XORFeome 2.0

flcn – XORFeome 2.0

General Information

Species: Xenopus tropicalis folliculin, mRNA (cDNA clone MGC:97623 IMAGE:6978808), complete cds
Gene Symbol: flcn
Gene ID: 496819
ORF gb_acc: MG134466
ORF ID: 12169

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC088516

Library Location

Plate ID: GDExt11021
Well Location: H08

EST Sequences

Clone: MGC:97623 IMAGE:6978808
Trimmed Sequence: ATGAACGCCATTGTGGCACTCTGCCATTTCTGTGAGCTCCATGGACCCCGCACTTTATTCTGCACAGAGGCTCTTCATTCACCGCACCCCCAAGGGGCGAGTTGTGGTGACAGCATTGGGCAGGGAGAGCAAGCAGAAGATGAGGAGATGGGAATTCAGATGAGCAGCAGGATCCGATGTCACAGCCCTGCAGAGGGGGCAAGTGCAGACTCCAACAGCCCCAGGCCCAAAAAGTCGGATATGTGTGAGGGTTGCAGGTCCTTAGCTGCGGGGCATCCTGGGTACATCAGCCATGATAAAGAGACTTCCATTAAATATGTCAGCCACCAACACCCCAACCACCCACAGCTGTTCAGCATTGTGCGCCAGGCCTGTGTGCGCAGCCTGAGTTGTGAGGTATGTCCTGGTAGAGAAGGTCCCATATTCTTTGGAGATGAGCAACATGGCTTTGTCTTTAGCCACACATTCTTCATTAAAGACAGTTTGGCTCGGGGGTTCCAGAGGTGGTACAGCATCATTGTCATTATGATGGACAGAATCTACCTGATCAACTCCTGGCCCTTCCTGCTGGCTAAGATAAGAGGTGTCATTGATGAACTGCAAGGGAAAGCACTAAAAGTGTTTGAAGCAGAACAGTTTGGCTGTCCCCAGCGCCCCCTGCGGATTAACACGGCTTTCACACCCTTTCTGCACCAGCGCAATGGAAACGCTGCCCGCTCTCTGACCTCTCTCACCAGTGATGATAACCTCTGGGCTTGCCTGCACACCTCTTTTGCATGGCTTCTGAAGGCTTGCGGGTGTCGCCTTACAGAGAAGCTATTAGAAGGAGCCCCCACAGAGGACACTCTGGTGCAGATGGAGAAGCAAGCAGACTTAGAGGAAGAGTGTGCAGCCAGGGAGGTTGCCGATGGGGAAGAAGGAAGACCCCGGCTGCAACCTGAACTTATGGAAGGCAGAGAGCTTTCAAAATGTCCCACTGAATCGTCAGTGCTGTCCGACTGCAGCTGGAATATGGTACAGAGGCGGATGGGTGTCTTTAGATCTCTCAGACACATGAGGCAGGTCCTGGGTGCTTCTGCTTTCCGCATGCTGGCCTGGCATGTTCTTATGGGGAATCAAGTCATCTGGAAGGGGCAAGACCAGGAGTTAATCCAGTCTGCATTTGATGTCTTGCAGGCCATGCTTCCCGTTGGCTGTGTTCGGGTCATACCATACAGTGAGAAGTATGAGGATGCCTATCGCTGCAACTTTCTAGGACTCAGCCCTCAGGCAGAGATCCCCCTTCATGTACAGTCATCTGAATTTTCTGTCATGGTGGATGTCCGCCATGCAAATCGCTCTAACCTTTACCCTGCCCTGTTTGTGGATGATGAGCCCCTGAGCAAATATGAATTTGTGGTGGCAAGCGGTAGCCCTGTGACCATTGACAAGGTTGGACTCACCATTTTAAACAAGATTGAAGCTGCTCTGAGCAATGAGAACCTGTCTATGGATGTGGTGGATCAGTGTCTAATCTGCCTGAAGGAGGAGTGGATGAATAAAGTGAAAGTACTCTTCAAGTTCACCAAAGTTGACAGCAGGCCCAAGGAGGACACACAGAAACTTCTCGGTATCCTTGGGGCTTCAGAAGAGGACAATATAAAGTTACTGAAATTCTGGATGACCGGTCTCAGCAAGACCTACAAATCTCACCTCATGTCCAGTGTGCGCAGCCCCACTGCCTCTGAATGCCGGAACTGA
Full Trace Sequence: gacgtgactggcagaacttgtatttctgctgaagaatctccaggtattaccatgaacgccattgtggcactctgccatttctgtgagctccatggaccccgcactttattctgcacagaggctcttcattcaccgcacccccaaggggcgagttgtggtgacagcattgggcagggagagcaagcagaagatgaggagatgggaattcagatgagcagcaggatccgatgtcacagccctgcagagggggcaagtgcagactccaacagccccaggcccaaaaagtcggatatgtgtgagggttgcaggtccttagctgcggggcatcctgggtacatcagccatgataaagagacttccattaaatatgtcagccaccaacaccccaaccacccacagctgttcagcattgtgcgccaggcctgtgtgcgcagcctgagttgtgaggtatgtcctggtagagaaggtcccatattctttggagatgagcaacatggctttgtctttagccacacattcttcattaaagacagtttggctcgggggttccagaggtggtacagcatcattgtcattatgatggacagaatctacctgatcaactcctggcccttcctgctggctaagataagaggtgtcattgatgaactgcaagggaaagcactaaaagtgtttgaagcagaacagtttggctgtccccagcgccccctgcggattaacacggctttcacaccctttctgcaccagcgcaatggaaacgctgcccgctctctgacctctctcaccagtgatgataacctctgggcttgcctgcacacctcttttgcatggcttctgaaggcttgcgggtgtcgccttacagagaagctattagaaggagcccccacagaggacactctggtgcagatggagaagcaagcagacttagaggaagagtgtgcagccagggaggttgccgatggggaagaaggaagaccccggctgcaacctgaacttatggaaggcagagagctttcaaaatgtcccactgaatcgtcagtgctgtccgactgcagctggaatatggtacagaggcggatgggtgtctttagatctctcagacacatgaggcaggtcctgggtgcttctgctttccgcatgctggcctggcatgttcttatggggaatcaagtcatctggaaggggcaagaccaggagttaatccagtctgcatttgatgtcttgcaggccatgcttcccgttggctgtgttcgggtcataccatacagtgagaagtatgaggatgcctatcgctgcaactttctaggactcagccctcaggcagagatcccccttcatgtacagtcatctgaattttctgtcatggtggatgtccgccatgcaaatcgctctaacctttaccctgccctgtttgtggatgatgagcccctgagcaaatatgaatttgtggtggcaagcggtagccctgtgaccattgacaaggttggactcaccattttaaacaagattgaagctgctctgagcaatgagaacctgtctatggatgtggtggatcagtgtctaatctgcctgaaggaggagtggatgaataaagtgaaagtactcttcaagttcaccaaagttgacagcaggcccaaggaggacacacagaaacttctcggtatccttggggcttcagaagaggacaatataaagttactgaaattctggatgaccggtctcagcaagacctacaaatctcacctcatgtccagtgtgcgcagccccactgcctctgaatgccggaactgacatgcatactcactacaggagccccgggctggtaatttcgtagtattacgaacagcatatattatttattgagcctttctttatccgtgtgaaaactggactcccatagccagccggactcaacgactgcccttgcttcggctgaatggactggagctgttgttttggggactgaattgcaccctgatgtagatgacaagtccagatataatctgccttggaagtaccagactttatacaaggagatgaactgtatatgtacaaccataaaaagaatatataagaggaaattaacccacataaataacttcattaaacagtaattcataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MNAIVALCHFCELHGPRTLFCTEALHSPHPQGASCGDSIGQGEQAEDEEMGIQMSSRIRCHSPAEGASADSNSPRPKKSDMCEGCRSLAAGHPGYISHDKETSIKYVSHQHPNHPQLFSIVRQACVRSLSCEVCPGREGPIFFGDEQHGFVFSHTFFIKDSLARGFQRWYSIIVIMMDRIYLINSWPFLLAKIRGVIDELQGKALKVFEAEQFGCPQRPLRINTAFTPFLHQRNGNAARSLTSLTSDDNLWACLHTSFAWLLKACGCRLTEKLLEGAPTEDTLVQMEKQADLEEECAAREVADGEEGRPRLQPELMEGRELSKCPTESSVLSDCSWNMVQRRMGVFRSLRHMRQVLGASAFRMLAWHVLMGNQVIWKGQDQELIQSAFDVLQAMLPVGCVRVIPYSEKYEDAYRCNFLGLSPQAEIPLHVQSSEFSVMVDVRHANRSNLYPALFVDDEPLSKYEFVVASGSPVTIDKVGLTILNKIEAALSNENLSMDVVDQCLICLKEEWMNKVKVLFKFTKVDSRPKEDTQKLLGILGASEEDNIKLLKFWMTGLSKTYKSHLMSSVRSPTASECRN
Donor tissue: tailbud