ORFeome > fth1 – XORFeome 2.0

fth1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ferritin, heavy polypeptide 1, mRNA (cDNA clone MGC:75775 IMAGE:5381874), complete cds
Gene Symbol: fth1
Gene ID: 394604
ORF gb_acc:
ORF ID: 10315

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061303

Library Location

Plate ID: GDExt11003
Well Location: G11

EST Sequences

Clone: MGC:75775 IMAGE:5381874
Trimmed Sequence: ATGCAATCCCAGGTGCGTCAGAACTTCAACAGCGACTGCGAAGCCGCCATCAACCGTATGGTGAACATGGAGTTGTATGCCTCCTATGTCTATCTGTCCATGTCTTACTATTTCGATCGTGATGACGTGGCACTCCACCATGTGGCCAAGTTCTTCAAGGAGCAGAGTCATGAGGAAAGGGAGCATGCCGAAAAGTTCCTCAAATACCAAAACAAACGTGGGGGCCGCGCCGTCCTTCAGGATATCAAGAAACCAGAGCGTGACGAATGGGGTAACACCCTGGAAGCCATGCAGGCCGCTCTGCAGCTGGAGAAGACTGTGAACCAGGCTTTACTGGATCTGCACAAGCTGGCATCTGACAAGACTGATCCTCATCTCTGCGACTTCCTGGAATCTGAGTACTTGGAGGAACAGGTGAAGGCCATGAAGGAGCTTGGAGACTACATCACAAACCTGAAGCGCCTTGGGGTGCCGCAGAATGGCATGGGCGAGTACCTGTTCGACAAGCACACCCTGGGGGAGAGTAGCTAA
Full Trace Sequence: cttcaacagtgtttgaacggaaccctctctgagtcttttttagaccaaaatctctctctctctcttgcattactcttttttttgtgacttttttgcgccaccagcaaacaccgaaacgccgccatgcaatcccaggtgcgtcagaacttcaacagcgactgcgaagccgccatcaaccgtatggtgaacatggagttgtatgcctcctatgtctatctgtccatgtcttactatttcgatcgtgatgacgtggcactccaccatgtggccaagttcttcaaggagcagagtcatgaggaaagggagcatgccgaaaagttcctcaaataccaaaacaaacgtgggggccgcgccgtccttcaggatatcaagaaaccagagcgtgacgaatggggtaacaccctggaagccatgcaggccgctctgcagctggagaagactgtgaaccaggctttactggatctgcacaagctggcatctgacaagactgatcctcatctctgcgacttcctggaatctgagtacttggaggaacaggtgaaggccatgaaggagcttggagactacatcacaaacctgaagcgccttggggtgccgcagaatggcatgggcgagtacctgttcgacaagcacaccctgggggagagtagctaagcgcactctcagggtggaaacaaccagtcagctctctgtttcaaaatactgtctctttactatctgtgtggattacaccatagctcccatgcccctgttgacacctttttatcttgaggatgatgggaataaatctgtgctattactgttctgaatcatgcagaagctgctgtgcttgtcaacatgttttcaataaagttttttcagcattccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MQSQVRQNFNSDCEAAINRMVNMELYASYVYLSMSYYFDRDDVALHHVAKFFKEQSHEEREHAEKFLKYQNKRGGRAVLQDIKKPERDEWGNTLEAMQAALQLEKTVNQALLDLHKLASDKTDPHLCDFLESEYLEEQVKAMKELGDYITNLKRLGVPQNGMGEYLFDKHTLGESS
Donor tissue: tadpole