ORFeome > g22p1 – XORFeome 2.0

g22p1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis thyroid autoantigen 70kDa (Ku antigen), mRNA (cDNA clone MGC:88890 IMAGE:6998470), complete cds
Gene Symbol: g22p1
Gene ID: 448213
ORF gb_acc: MG134071
ORF ID: 11691

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075271

Library Location

Plate ID: GDExt11016
Well Location: B05

EST Sequences

Clone: MGC:88890 IMAGE:6998470
Trimmed Sequence: ATGAATGAATGGGGGGAGTATTTTGTAAAGGAGGAAGATGAAGATGACGAGGAGCAGGAAGAAGGAGAAAGAGATGCTGGTGTGTTTCGTTTTGCGGGTCGTGACAGCCTAATCTTCCTTATTGATGCCTCCAAGCCAATGTTTGAGAGTACTGGTGATGAACTGACCCCATTTGACCTTACATTGCAGTGCATTCGCAGTGTCTATGCCAGCAAGATCATTAGCAGTGACCATGACCTGCTGTCTGTGGTTTTCTTTGGCACTCGAGAGAGCAATAACTGTGATCCATTCAAACACCTCTGTGTCCTTCATGATCTGGATACCCCAGGTGCTAAACGCATCCTTGATCTGGATAAGTACAAAGAGGAAAAGGGAAGAGCATTATTCCGTGACACCATAGGGTGTGGTGGAGACTTTTCTTTGGGAGAGGCTCTTTGGCTTTGCTCAAATCTGTTCAGCAACGTAAAAGTCAAAATGAGCCACAAGCGCATAATGTTGTTTACTAATGAAGACAACCCTCATGCAAATGACCAAGCCAAAGCCAAGCAGGCAAGAGCCAAAGCAGAGGACCTTAGGGAAATGGGGATCTTTCTGGATCTAATGCATCTGGAGAAACCTGAGGGGTTTGACATCTCTTTGTTTTATCGTGACATTGTTAATACTGCTGAGGATCAGGATCTCGGGGTGCAATTTAAGGCTTCTGAAAAACTGGATGATCTGTTAAAGAAGGTGCGAGCCAAGGAAGCAAAGAAAAGGGCTCTGGCAAGACTGACTTTAAAGCTTGGGCCTGACGTTGGCCTTACTGTGGGCATTTATAACTTGGTGCAAAAAGCTGTAAAACCTCCCACAGTGAAGCTTTATCGTGAATCAAATGAGCCAGTGAAGACTAAGACCAGGATCTTCCATAGTAACACAGGGAGCCTGCTGCTTCCAAGCGATACCAAGAGGTCTCAGACATACGGAAATCGTCAGATTGTCTTGGAAAAGGATGAGACAGAGCAGCTAAAGAGATTTGATGAACCCAGCTTAGTGCTGATCGGATTCAAACCCATTACATTTTTAAAAAAACATCATTTCACGAGACCTGCCCAGTTTATTTATCCAGAAGAATCTCTTATAAATGGAAGCACCACTCTGTTTCATGCTTTGCTTCTAAGGTGCTTAGCTCAGCAGGTGATGGCCATCTGTAGGTACACACCTCGTAGAAACACACCCCCTCGCTTTGTGGCATTGGTGCCCCAGGATGAGGAATTAGATGATCAAAATATACAGAGCAAACCTCCTGGCTTCAATCTTGTTTTTCTTCCGTTTGCTGATGACATCCGGAAAATTGACCCCCCGGAAAAGATTACTGCAAATGAAGAACAAGTGGATAAGATGAAGGAAATTGTGCATAAACTGCGCTTTAACTTCAGGAGTGATAGTTTTGAAAACCCTGTACTTCAGCAGCACTTTCGGAATTTGGAGGCTCTTGCATTGGATATGCTAGAGCCTGAACCCATTGAGGATCTGACATTGCCAAAGGTGGAAATGATTGATCGTCGCTTAGGGACTCTAGTTGAAGAGTTTAAAGAGCTTGTTTATCCACCTGGGTACAACCCAGAGGGCAAAGCTGTAAAGCGAAAACAAGCAGGTGACAGCGACAGTCGAGCGGAGAAGAAAGCCAAAGCAGACATCTCCATCTCAGAAGATGATCTTAGGTCCTATGTAGATAAAGGAACTCTGGGCAAACTGACAGTACCTGTGTTAAAGGAAGCATGTCGTGGGTATAAACTGAAAGGGAGCAAGAAGCAGGAGTTGGTTGATTCCCTTGTAGAGTACTTCAAGAAGAACTAG
Full Trace Sequence: ggataacacaagcaacattacgctgcattttagctcttgaataaccaggatgtctttcccttttcagagggatcatgggccttaaacacgaaattctgtagctgctataaccctgcaattccaaacatactgatgtatatagaatgcatgtagtactaggccaacaacctctgcagtgttggaaaactgagtatagggctctaccaaaagcttgaatctcgtggctggactcagtaatgtgctacatagcacccctgcattgttcacacctatcaaaaaatgaatgaatggggggagtattttgtaaaggaggaagatgaagatgacgaggagcaggaagaaggagaaagagatgctggtgtgtttcgttttgcgggtcgtgacagcctaatcttccttattgatgcctccaagccaatgtttgagagtactggtgatgaactgaccccatttgaccttacattgcagtgcattcgcagtgtctatgccagcaagatcattagcagtgaccatgacctgctgtctgtggttttctttggcactcgagagagcaataactgtgatccattcaaacacctctgtgtccttcatgatctggataccccaggtgctaaacgcatccttgatctggataagtacaaagaggaaaagggaagagcattattccgtgacaccatagggtgtggtggagacttttctttgggagaggctctttggctttgctcaaatctgttcagcaacgtaaaagtcaaaatgagccacaagcgcataatgttgtttactaatgaagacaaccctcatgcaaatgaccaagccaaagccaagcaggcaagagccaaagcagaggaccttagggaaatggggatctttctggatctaatgcatctggagaaacctgaggggtttgacatctctttgttttatcgtgacattgttaatactgctgaggatcaggatctcggggtgcaatttaaggcttctgaaaaactggatgatctgttaaagaaggtgcgagccaaggaagcaaagaaaagggctctggcaagactgactttaaagcttgggcctgacgttggccttactgtgggcatttataacttggtgcaaaaagctgtaaaacctcccacagtgaagctttatcgtgaatcaaatgagccagtgaagactaagaccaggatcttccatagtaacacagggagcctgctgcttccaagcgataccaagaggtctcagacatacggaaatcgtcagattgtcttggaaaaggatgagacagagcagctaaagagatttgatgaacccagcttagtgctgatcggattcaaacccattacatttttaaaaaaacatcatttcacgagacctgcccagtttatttatccagaagaatctcttataaatggaagcaccactctgtttcatgctttgcttctaaggtgcttagctcagcaggtgatggccatctgtaggtacacacctcgtagaaacacaccccctcgctttgtggcattggtgccccaggatgaggaattagatgatcaaaatatacagagcaaacctcctggcttcaatcttgtttttcttccgtttgctgatgacatccggaaaattgaccccccggaaaagattactgcaaatgaagaacaagtggataagatgaaggaaattgtgcataaactgcgctttaacttcaggagtgatagttttgaaaaccctgtacttcagcagcactttcggaatttggaggctcttgcattggatatgctagagcctgaacccattgaggatctgacattgccaaaggtggaaatgattgatcgtcgcttagggactctagttgaagagtttaaagagcttgtttatccacctgggtacaacccagagggcaaagctgtaaagcgaaaacaagcaggtgacagcgacagtcgagcggagaagaaagccaaagcagacatctccatctcagaagatgatcttaggtcctatgtagataaaggaactctgggcaaactgacagtacctgtgttaaaggaagcatgtcgtgggtataaactgaaagggagcaagaagcaggagttggttgattcccttgtagagtacttcaagaagaactagactgcaagtctggtgcataattcatatattctctactcttatctttcaaatagtggattagtgacagttaaaaatcaatttacataaattctctcatatttgtagatgtgatatattttcatggatcttgtttcctataaagcacttgtaattaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MNEWGEYFVKEEDEDDEEQEEGERDAGVFRFAGRDSLIFLIDASKPMFESTGDELTPFDLTLQCIRSVYASKIISSDHDLLSVVFFGTRESNNCDPFKHLCVLHDLDTPGAKRILDLDKYKEEKGRALFRDTIGCGGDFSLGEALWLCSNLFSNVKVKMSHKRIMLFTNEDNPHANDQAKAKQARAKAEDLREMGIFLDLMHLEKPEGFDISLFYRDIVNTAEDQDLGVQFKASEKLDDLLKKVRAKEAKKRALARLTLKLGPDVGLTVGIYNLVQKAVKPPTVKLYRESNEPVKTKTRIFHSNTGSLLLPSDTKRSQTYGNRQIVLEKDETEQLKRFDEPSLVLIGFKPITFLKKHHFTRPAQFIYPEESLINGSTTLFHALLLRCLAQQVMAICRYTPRRNTPPRFVALVPQDEELDDQNIQSKPPGFNLVFLPFADDIRKIDPPEKITANEEQVDKMKEIVHKLRFNFRSDSFENPVLQQHFRNLEALALDMLEPEPIEDLTLPKVEMIDRRLGTLVEEFKELVYPPGYNPEGKAVKRKQAGDSDSRAEKKAKADISISEDDLRSYVDKGTLGKLTVPVLKEACRGYKLKGSKKQELVDSLVEYFKKN
Donor tissue: