ORFeome > galnt7 – XORFeome 2.0

galnt7 – XORFeome 2.0

General Information

Species: Xenopus tropicalis UDP-N-acetyl-alpha-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase 7, mRNA (cDNA clone MGC:76103 IMAGE:5308366), complete cds
Gene Symbol: galnt7
Gene ID: 407859
ORF gb_acc: MG133431
ORF ID: 10947

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067317

Library Location

Plate ID: GDExt11009
Well Location: D07

EST Sequences

Clone: MGC:76103 IMAGE:5308366
Trimmed Sequence: ATGAGGCTGAAGCCTGGCTTTCTCCTGCGGAGCCTGCTCGTGCTGGCCACTTTCCTCATGTTTCTCATCATCTGGACCTCTTTTTCAAGCTCTGGGAGCACAGAATCACGTTTGCAACGGGAAGAAAACCCCAACCTTCCTCAGGCTGTCAAGCCGGACGCAAATGCACCCAAAGATGATTTCCACCCAGTGGTGCCATGGCCTCGTGTTGAGGGAGTAGAAGTTAACCTTGATTCTATTCGTAAGAAAAACAAAGAGAGATTGGAGCAAGATCATTTGGAGGCGAAGGTTAATAACCAAGAGCACGTCATGGAGAAACAGTATCTTACGTTCAAACCTCAGACACATATTTATTCTGATCCAGTGCTGCGTCCTGGTATTTTGGGCAATTTGGAACCTAAAGAACCAGAGCCCCAAGGGGTTGTGGGTGGCCCAGGAGAGGGAGGAAAACCTTTTGAGTTGGGACCAGATTACAAGGATGCGGTCAAAGCCAGCATTAAAGAGTTTGGTTTTAACATGGTGGCAAGTGATATGATCTCAATGGATCGGACGATAAACGACTTGCGTCATGAAGAGTGCAAGTACTGGAATTATGACGAGAACCTGCTCACCTCCAGTGTAGTAATTGTCTTCCACAATGAGGGTTGGTCTACCCTAGTGAGAACTATTCACAGTGTCATCAAACGAACACCCAGACAGTACCTGGCTGAGATTGTTATGATTGATGATTTCAGTAACAAAGAACATCTAAAAGGCCGACTGGATGAATACCTTAAGCAGTGGAATGGCCTTGTGAAGGTTTTCAGAAATGAGCGGAGAGAAGGGTTGATCCAGGCCAGAAGCATCGGAGCAGAGAAAGCAAAACTTGGACAGGTTTTGATTTATCTAGATGCACATTGTGAGGTGGGAATTAACTGGTATGCACCATTAATAGCACCCATAGCCAAAGACAGAACTGCTTGCACTGTTCCTCTCATAGATTACATTGATGGCAATTTGTATACCATTGAGCCGCAGCAAGGTGGGGATGAAGATGGTTTTGCTCGTGGGGCCTGGGACTGGAGCATGTTGTGGAAGCGTATTCCATTAACCGTCAGAGAAAAGGCCAAAAGAAAGCATAAAACTGAGCCGTATTGGTCCCCTGCAATGGCTGGAGGCCTGTTTGCCATTGAGCGAGATTATTTTTTCGAACTAGGTCTTTATGATCCAGGTTTGCAGATCTGGGGTGGTGAAAATTTTGAAATTTCCTACAAGATATGGCAATGTGGAGGAAAATTGTTGTTTACTCCCTGTTCTCGTGTAGGACACATTTACCGTCTACATGGATGGCAAGGAAACCCTACTCCTGTCTATGTTGGAGCTTCTCCAACGCTGAAGAATTATATTAGAGTGGTGGAGGTCTGGTGGGATGAATACAAAGATTATTTCTATGCCAGTCGTCCAGAAACCAAAGCTCTTCCCTACGGGGACATTGGTCCACTGAAGAAGTTCCGTGAGGATCACAACTGCAAAAGCTTTAAATGGTTCATGGAGGAAATTGCGTATGATATCACCAAATACTTTCCACTTCCACCTAAAAATGTTGAATGGGGAGAGATTAGAGGCTTTGAGACGAATTACTGCATTGACAGTATGGGCCATACCAACGGAGGGATTGTGGAACTGGGGGGATGCCACAGAATGGGAGGAAATCAACTTTTCCGTATAAATGAAGCAAATCAGTTGATGCAGTATGATCAGTGTCTCTATAAAGGGCCGGATGGCACGCAGGTCATGCTTACACACTGTAATTTAAAAGAATTCTTGGAATGGCAGTACTTTAAGAACATGCACCGATTCCTCCACATTTCTACAGGAAAGTGCTTAGATCGTTCAGAGGTTCTCCACCAAGTGTTCCTATCAGACTGTGACGCAAACAAACCCACTCAGAAATGGGAAATGAATAACATCCTTGGGGTATAA
Full Trace Sequence: agctggcagctttcaaagaagcagggtctatgcctgtttgtgtgcagcacttttgtttcgtggccgccgctgttcctatccttctgctcgcctggcgctgatcacattactttcatctcgggctccctccttcatctgagaattatgaggctgaagcctggctttctcctgcggagcctgctcgtgctggccactttcctcatgtttctcatcatctggacctctttttcaagctctgggagcacagaatcacgtttgcaacgggaagaaaaccccaaccttcctcaggctgtcaagccggacgcaaatgcacccaaagatgatttccacccagtggtgccatggcctcgtgttgagggagtagaagttaaccttgattctattcgtaagaaaaacaaagagagattggagcaagatcatttggaggcgaaggttaataaccaagagcacgtcatggagaaacagtatcttacgttcaaacctcagacacatatttattctgatccagtgctgcgtcctggtattttgggcaatttggaacctaaagaaccagagccccaaggggttgtgggtggcccaggagagggaggaaaaccttttgagttgggaccagattacaaggatgcggtcaaagccagcattaaagagtttggttttaacatggtggcaagtgatatgatctcaatggatcggacgataaacgacttgcgtcatgaagagtgcaagtactggaattatgacgagaacctgctcacctccagtgtagtaattgtcttccacaatgagggttggtctaccctagtgagaactattcacagtgtcatcaaacgaacacccagacagtacctggctgagattgttatgattgatgatttcagtaacaaagaacatctaaaaggccgactggatgaataccttaagcagtggaatggccttgtgaaggttttcagaaatgagcggagagaagggttgatccaggccagaagcatcggagcagagaaagcaaaacttggacaggttttgatttatctagatgcacattgtgaggtgggaattaactggtatgcaccattaatagcacccatagccaaagacagaactgcttgcactgttcctctcatagattacattgatggcaatttgtataccattgagccgcagcaaggtggggatgaagatggttttgctcgtggggcctgggactggagcatgttgtggaagcgtattccattaaccgtcagagaaaaggccaaaagaaagcataaaactgagccgtattggtcccctgcaatggctggaggcctgtttgccattgagcgagattattttttcgaactaggtctttatgatccaggtttgcagatctggggtggtgaaaattttgaaatttcctacaagatatggcaatgtggaggaaaattgttgtttactccctgttctcgtgtaggacacatttaccgtctacatggatggcaaggaaaccctactcctgtctatgttggagcttctccaacgctgaagaattatattagagtggtggaggtctggtgggatgaatacaaagattatttctatgccagtcgtccagaaaccaaagctcttccctacggggacattggtccactgaagaagttccgtgaggatcacaactgcaaaagctttaaatggttcatggaggaaattgcgtatgatatcaccaaatactttccacttccacctaaaaatgttgaatggggagagattagaggctttgagacgaattactgcattgacagtatgggccataccaacggagggattgtggaactggggggatgccacagaatgggaggaaatcaacttttccgtataaatgaagcaaatcagttgatgcagtatgatcagtgtctctataaagggccggatggcacgcaggtcatgcttacacactgtaatttaaaagaattcttggaatggcagtactttaagaacatgcaccgattcctccacatttctacaggaaagtgcttagatcgttcagaggttctccaccaagtgttcctatcagactgtgacgcaaacaaacccactcagaaatgggaaatgaataacatccttggggtataagcctagcgactgtctgccagaggatggcctgacacctgctgcaatgaagaactatgtacagcctgcagtcttctcacttcagcgaaggaactgggacacctagaagattctgatagtgtcaccctgcagttaatgtttacaagactgcttttaccttaaacctttttagatgtttacatcatcttgtttcaagataatgatagtcaaagtgcttttagctttgtttagaggaacagagctaaagacaattatttttttgggattcttctcaggggctaaaaggtagattttatctcacacttgaaaatgatttgcttagctggacattcgtgttattttaggtgattgcattgatcttgatttttgtttctctatttttttttttttttttcttcagtgcactgccacagtttcttttagcgataaaaaataagacatataaaaaaaaaaatataaaaaaaaaaaaaaaa
Translation: MRLKPGFLLRSLLVLATFLMFLIIWTSFSSSGSTESRLQREENPNLPQAVKPDANAPKDDFHPVVPWPRVEGVEVNLDSIRKKNKERLEQDHLEAKVNNQEHVMEKQYLTFKPQTHIYSDPVLRPGILGNLEPKEPEPQGVVGGPGEGGKPFELGPDYKDAVKASIKEFGFNMVASDMISMDRTINDLRHEECKYWNYDENLLTSSVVIVFHNEGWSTLVRTIHSVIKRTPRQYLAEIVMIDDFSNKEHLKGRLDEYLKQWNGLVKVFRNERREGLIQARSIGAEKAKLGQVLIYLDAHCEVGINWYAPLIAPIAKDRTACTVPLIDYIDGNLYTIEPQQGGDEDGFARGAWDWSMLWKRIPLTVREKAKRKHKTEPYWSPAMAGGLFAIERDYFFELGLYDPGLQIWGGENFEISYKIWQCGGKLLFTPCSRVGHIYRLHGWQGNPTPVYVGASPTLKNYIRVVEVWWDEYKDYFYASRPETKALPYGDIGPLKKFREDHNCKSFKWFMEEIAYDITKYFPLPPKNVEWGEIRGFETNYCIDSMGHTNGGIVELGGCHRMGGNQLFRINEANQLMQYDQCLYKGPDGTQVMLTHCNLKEFLEWQYFKNMHRFLHISTGKCLDRSEVLHQVFLSDCDANKPTQKWEMNNILGV
Donor tissue: gastrula