ORFeome > golga4 – XORFeome 2.0

golga4 – XORFeome 2.0

General Information

Species: Xenopus tropicalis golgi autoantigen, golgin subfamily a, 4, mRNA (cDNA clone MGC:88992 IMAGE:7004036), complete cds
Gene Symbol: golga4
Gene ID: 448562
ORF gb_acc: MG134036
ORF ID: 11651

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076895

Library Location

Plate ID: GDExt11016
Well Location: F10

EST Sequences

Clone: MGC:88992 IMAGE:7004036
Trimmed Sequence: ATGGCCTCCGACGCGCCCCCCACTTCCATGCTCCAGCCGGAGGAGCGCAACTACTCTCAGGTGGTCTTCAGCAGGGTGGAGCAGTCCTATGTGCCTGGCATAGACATCATATGTTACTTTACTTACACCTCAGGGTTTCATCCTGCCAAGAAGGACTGGGTGGGCATCTTTAAGGTTTCCTGGAAGACAACTAGAGAGTACTACACCTGGGTCTCCGCTGATTGTGAAGAGCAGGGTTTGGAGAAGCGCGTGACCTTTAAAGCATATTACTTGCCCAAGGAAAGTGATGACTATTACCAGTTTTGCTATGTGGATCAGAAGGGCGAGGTGCGAGGTGTCAGCATCCCCTTCCAGTTGTGCCGCAAAATCCAGGATGAAGGCGAGGAGGACATTCTGCTGGTGACAACTGAGGAGGAGGCTCAAGGGATGAAGGAAAAGCAAAGGGTGCTAGAGGAAAAGGTAGCGGCCTTGGAGAAAGATAAATGCACCTTGCAAGATGAGTGCACACAGCTGGCTTTAGAACAGAAGAACAAAGCGGCACTGATAGAGTCTCTGCAGGCCCAGCAGTTGGAATGTGCCAAGAAAAATGAGGAGCTGGACCAACAAAATCAGGAGCTTGAAAGGCAACTAGAGGAGGAAAAATGCAAGAATGGGTCTCTTCACCTGAAGGTGGTATCTGCTGAAGAGGAGCGAGAGAGAGTGCAGAATGACATTAGATCCCTGCAGCTGGAGCAGAACCAGTTAAAGGAAGAAAATATGGAACTTCACAAACATACAAATGATATGGAGTTTTCACTGAAAAAATACTCAGAAGAAGCAAAAAATCAGGAGGAGGAGGTGCAAGAGCTAAAGGACAAGCTATGGGACGCAGAAGCAAAACATCACCTGCTCCAGGTGCAGCTGCAAGACATACAGATGGAGAAGAAGAAGGATAAGTATTCAATAGAATTGCTGACTAAGGAGGCTGAAAAGGTGGCTGATCTTAGGCAGAACCTGGAGAAGAAGGACAAGACTATGGAAACCATGGAAAAGCAGTTGGCTCAGTTGCAGAGAGAGAATGCAACTGTGCTGCGACAAATGGAGGACTTAAGCTACACCTTGGAACTGAGAAAGGCTGAAATCAGTGACATGCAACAGCAGCGCGTGAGAGATGGAGCAGAGATTGAGCATCTGAACCGCTTGCTCACTGAGCAATCTTCATCCACTCCCCGGAACCAAGGCCTGTTTTTCCAGAACCCTTACGAAAGCGAAAGTCTGATTTCATTTGCAAATGAGCCCCAGCCCGGAGAAGCTCCCGGAGGCAGCAGCGTGCGGCATGTACAAATGCAGTGCCCGGAGTGTGGGTCCGAGTTTGAGAATTTTCAGGTGTTTCAGGATCATATCTTCTGCCATGACCTGGAGTCAACAGAGTAA
Full Trace Sequence: tcgttttgtgccattctctgtttaactgccagctgcccttccactgtccttctgccatttttggtcttgtgcccagtgccatgtaaggagtgtgtccgatggcctccgacgcgccccccacttccatgctccagccggaggagcgcaactactctcaggtggtcttcagcagggtggagcagtcctatgtgcctggcatagacatcatatgttactttacttacacctcagggtttcatcctgccaagaaggactgggtgggcatctttaaggtttcctggaagacaactagagagtactacacctgggtctccgctgattgtgaagagcagggtttggagaagcgcgtgacctttaaagcatattacttgcccaaggaaagtgatgactattaccagttttgctatgtggatcagaagggcgaggtgcgaggtgtcagcatccccttccagttgtgccgcaaaatccaggatgaaggcgaggaggacattctgctggtgacaactgaggaggaggctcaagggatgaaggaaaagcaaagggtgctagaggaaaaggtagcggccttggagaaagataaatgcaccttgcaagatgagtgcacacagctggctttagaacagaagaacaaagcggcactgatagagtctctgcaggcccagcagttggaatgtgccaagaaaaatgaggagctggaccaacaaaatcaggagcttgaaaggcaactagaggaggaaaaatgcaagaatgggtctcttcacctgaaggtggtatctgctgaagaggagcgagagagagtgcagaatgacattagatccctgcagctggagcagaaccagttaaaggaagaaaatatggaacttcacaaacatacaaatgatatggagttttcactgaaaaaatactcagaagaagcaaaaaatcaggaggaggaggtgcaagagctaaaggacaagctatgggacgcagaagcaaaacatcacctgctccaggtgcagctgcaagacatacagatggagaagaagaaggataagtattcaatagaattgctgactaaggaggctgaaaaggtggctgatcttaggcagaacctggagaagaaggacaagactatggaaaccatggaaaagcagttggctcagttgcagagagagaatgcaactgtgctgcgacaaatggaggacttaagctacaccttggaactgagaaaggctgaaatcagtgacatgcaacagcagcgcgtgagagatggagcagagattgagcatctgaaccgcttgctcactgagcaatcttcatccactccccggaaccaaggcctgtttttccagaacccttacgaaagcgaaagtctgatttcatttgcaaatgagccccagcccggagaagctcccggaggcagcagcgtgcggcatgtacaaatgcagtgcccggagtgtgggtccgagtttgagaattttcaggtgtttcaggatcatatcttctgccatgacctggagtcaacagagtaactgtaggcaggctatccccttatcagcccctcgctctgctgactcgactgggttagatttgggactgaatagacatggggcttttgcctacttatcctgcactttcacctctttccttgtccatttccggcttttatagtgtgattaatataactgatgatatacagtatatagacaatagtttgggggctttactgttttttgtgtgtgttctagtgtccagttagcaactggccaagaagtgggggttaagatgatcctttctgaatgatatactactccagggtcttattttggccaacccaaaatataatttttgcccaattaaagaaaacatcattctaagcagctgtgcagtacacattaactacaaatgtatatataattgctattagaagtgtttgtctgtctttttctattctctgccttgggggccctgactcagcccaagacagcagcctgacagacctgcctcgctggaggagactgacctttgcaacattgtttaacaagtaacaaccaggagttcagcaaatgctgctttcaatagcaattacatttacacataacttttaaagcactaaacattttcaatacattcacattggaaagttgcttggaattatgtttttgtttattaggcaaaaatgtatttttggggttgacatccatgggaatcctgaccttcagatacaaagcacttatgagctacttgtgcacttcttgccccccaccattattgtatctgtaggttaaaaattgtaagctcttcaggacatggacctgtgtctttttgctcagcacttaagtattttattctgctaatttgtaaaattgaatctccatactgtttgtatgttttgaatagggattttttaacccctgtggtgcaatatataaatgaatgcgatgcctatgattatggacttggagattgatgatgcattgtctgttgtgtcttcttttgtgatttgtatttgtgatatgttcgaaaaaaaagaccctattctttattctgcaaggagtctatagggggaattcacaaaagtggaggtagtggttgtcaaccgccacttttcatttttttggggaaggaaagacacctctgttaaaattgtccctactgtatgtatatgggatagggaccttagattgtaagctcctctggggcaggaactggtgtatgatgaataatcttggtaaagcgctgcggaaatgtgtccgcattatataagggatgaaaactctactttgggccctgaacagtataaagtttcccccagttacagtactgtaccatatttctactttgctcccatgactttaggggggtcctgccgcaggatagggcaagtatggtgggagctagatacacatgagtgttgcatttagaccaatacctgggccttcaacccacatttgtacccactgacacggtcatagactgggaatggcattatgtaagggtagggaaagggaacccatacctacaaacagggtcggaccggggggtgcagggcccaccgaggctcccgctggccgcgtcccctaaccccccccaggggccccccaaaacccccccccaaccgatgtcttccccgagcgtgcataaatttaacgtcagcggaggaacagtcgggcagggggagcgccagcaaaggtcgggtctgggccgccggggcccacagggatttgtcccggcagcccagtccgaccctgcctacaaatcctaccgcaatccatctaatacctgcattgggaggtagctgaaagagctggagggtcagggggcggtagaatgaaacaaggaagctatgggttggttctggatctccaatcaccagttgttttgctgttcatctgggcatgaagggtttgaatgagggctggaagggcctttatgatcactgcaggttgtatagatgggctagcttatatcagatacatagaacttgccaggtttcatattattaaactgtatcaacttatagaggtagttttcgattttgaaatgacgcaacattgactaaagtgattatatataatgtggttgaaaactcttctgaaggattcccctgaactttgcattaaattataactgtatttctcttatatggaatttctaaatgaataaataacatattggaagtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MASDAPPTSMLQPEERNYSQVVFSRVEQSYVPGIDIICYFTYTSGFHPAKKDWVGIFKVSWKTTREYYTWVSADCEEQGLEKRVTFKAYYLPKESDDYYQFCYVDQKGEVRGVSIPFQLCRKIQDEGEEDILLVTTEEEAQGMKEKQRVLEEKVAALEKDKCTLQDECTQLALEQKNKAALIESLQAQQLECAKKNEELDQQNQELERQLEEEKCKNGSLHLKVVSAEEERERVQNDIRSLQLEQNQLKEENMELHKHTNDMEFSLKKYSEEAKNQEEEVQELKDKLWDAEAKHHLLQVQLQDIQMEKKKDKYSIELLTKEAEKVADLRQNLEKKDKTMETMEKQLAQLQRENATVLRQMEDLSYTLELRKAEISDMQQQRVRDGAEIEHLNRLLTEQSSSTPRNQGLFFQNPYESESLISFANEPQPGEAPGGSSVRHVQMQCPECGSEFENFQVFQDHIFCHDLESTE
Donor tissue: