ORFeome > gpsn2 – XORFeome 2.0

gpsn2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis gpsn2 protein, mRNA (cDNA clone MGC:89727 IMAGE:7027032), complete cds
Gene Symbol: gpsn2
Gene ID: 493561
ORF gb_acc: MG133051
ORF ID: 10455

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080144

Library Location

Plate ID: GDExt11005
Well Location: A04

EST Sequences

Clone: MGC:89727 IMAGE:7027032
Trimmed Sequence: ATGAAACACCATGAGGTGGAGATCCTGGATGCCAAAACGCGGGAGAAGCTGTGCTTCTTAGACAAGGTGGAGCCCCATGCCACCATAGCAGATATAAAGAATATGTTCACCAAATCCCATCCTCAGTGGTACCCTGCGCGGCAGTCTCTACGCCTGGATCCAAAGGGCAGATCGCTGAAGGATGAAGACATCTTACAGAACCTACCAGTGGGGACAACAGCCACCCTGTACTTTAGAGATCTGGGTGCACAGATCAGCTGGGTGACGGTGTTCCTCACAGAATACGCTGGGCCTCTCGTTATATATCTGCTCTTCTATTTCCGAGTTCCTTTTATTTATGGTCCCAAGTATGATTTTATTACCAGCCGGCATTCTGTGGTACACCTGGCCTGTATCTGCCATTCTTTTCATTACATTAAACGTCTACTGGAGACCCTGTTCGTCCATCGTTTCTCTCATGGTACAATGCCGTTCCGGAATATCTTTAAGAACTGTATGTATTACTGGGGATTTGCAGCTTGGATGGCTTACTACATAAACCACCCACTCTACACACCACCGACATATGGAGAAAATCAGGTGAAGCTGGCGGTCATTATATTTCTGTTTTGCCAGCTGGGTAATTTCTCCATACACATTGCTTTGCGGAATCTGCGACCTGCTGGTTCCAAGACCCGAAAGATTCCCTTCCCCACACGTAATCCTTTCACATGGCTGTTCCTGCTGGTTTCCTGTCCCAACTACACATATGAGGTTGGCTCTTGGATTGGATTTGCCATCATGACCCAGTGTCTCCCAGTCGCTCTCTTTACCTTGGTTGGATTCATCCAGATGACGATTTGGGCCAAAGGCAAACACCGAAGTTACTTGAAGGAGTTCCGAGATTACCCTCCTCTCCGATCCCCCATAGTTCCCTTCATCCTGTAG
Full Trace Sequence: ggtttccccgcccccggttgaagcttagtggcaggtagaagagaagcgtgtttgctccaggggagccctgcggaatcatgaaacaccatgaggtggagatcctggatgccaaaacgcgggagaagctgtgcttcttagacaaggtggagccccatgccaccatagcagatataaagaatatgttcaccaaatcccatcctcagtggtaccctgcgcggcagtctctacgcctggatccaaagggcagatcgctgaaggatgaagacatcttacagaacctaccagtggggacaacagccaccctgtactttagagatctgggtgcacagatcagctgggtgacggtgttcctcacagaatacgctgggcctctcgttatatatctgctcttctatttccgagttccttttatttatggtcccaagtatgattttattaccagccggcattctgtggtacacctggcctgtatctgccattcttttcattacattaaacgtctactggagaccctgttcgtccatcgtttctctcatggtacaatgccgttccggaatatctttaagaactgtatgtattactggggatttgcagcttggatggcttactacataaaccacccactctacacaccaccgacatatggagaaaatcaggtgaagctggcggtcattatatttctgttttgccagctgggtaatttctccatacacattgctttgcggaatctgcgacctgctggttccaagacccgaaagattcccttccccacacgtaatcctttcacatggctgttcctgctggtttcctgtcccaactacacatatgaggttggctcttggattggatttgccatcatgacccagtgtctcccagtcgctctctttaccttggttggattcatccagatgacgatttgggccaaaggcaaacaccgaagttacttgaaggagttccgagattaccctcctctccgatcccccatagttcccttcatcctgtaggcacactcatggttccctctgttccttgctcttcctttctaactctagttcttaaaatgaccaccaatatccaactgtctgctaaacactggcctctaaactcttgcactgatatatagagtatggaaggtttgtgcttcccagatggaataaacgtgtcctctgttaaagaaaaaaaaaaaaaaaa
Translation: MKHHEVEILDAKTREKLCFLDKVEPHATIADIKNMFTKSHPQWYPARQSLRLDPKGRSLKDEDILQNLPVGTTATLYFRDLGAQISWVTVFLTEYAGPLVIYLLFYFRVPFIYGPKYDFITSRHSVVHLACICHSFHYIKRLLETLFVHRFSHGTMPFRNIFKNCMYYWGFAAWMAYYINHPLYTPPTYGENQVKLAVIIFLFCQLGNFSIHIALRNLRPAGSKTRKIPFPTRNPFTWLFLLVSCPNYTYEVGSWIGFAIMTQCLPVALFTLVGFIQMTIWAKGKHRSYLKEFRDYPPLRSPIVPFIL
Donor tissue: