ORFeome > gtf2f2 – XORFeome 2.0

gtf2f2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis general transcription factor 2F, polypeptide 2, 30kDa, mRNA (cDNA clone MGC:75790 IMAGE:5382110), complete cds
Gene Symbol: gtf2f2
Gene ID: 394584
ORF gb_acc: MG132898
ORF ID: 10263

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061312

Library Location

Plate ID: GDExt11003
Well Location: G07

EST Sequences

Clone: MGC:75790 IMAGE:5382110
Trimmed Sequence: ATGGCCGCCGAGAAAGGGGATTTGGACCTGAATGGAGCAAAACAGAATACCGGAATGTGGCTTGTCAAGCTCCCAAAGTACTTGGCCCAGCAGTGGGCAAAAGCAACCGGCAGAGGAGAAGTTGGAAAGCTGAGAATTGTTAAAAATCAAGGAAAAACAGAGGTGTCCTTTACCCTTAATGAAGAACTTGCAAGCATTCAGGATATTGGAGGAAAGCCAGCATCATCCTTAGTCACTGCACCCAGGGAACATCCGTTTCTGCTACAGTCTGTGGGGGGACAAACTCTCACAGTGTTTACTGAAAGCTTATCAGGTCAATCTGATGACAAATCTGAAAACCGGGTTATAGATAAACTTGCTTTGGAGGGTATTGTGGTGCATCGTGCTGAGTGTAGACCAGCTGCTAGTGAAAACTACATGCAAATGAAGAGAAAACAGATTGAAGAATCTTCCAAACCAAAGAGGCAATCACAACAGATAGAAAAGGCAGTAACGACAAACTACAGACCAGTGTCAAACCATCAGTACAATATTGAGTACGAGAAGAAGAAAAAGGATGACGGCAAGCGAGCCCGAGCAGATAAGCACCAGGTTTTGGATATGTTGTTCTCTGCATTTGAAAAACACCAGTACTACAACATTAAGGATCTCGTGGACATTACCAAGCAACCCGTGAGTTATCTAAAAGAAATTCTGAGAGACATTGGAATTTACAACATGAAAGGAACTCACAAGAACACATGGGAGCTTAAGCCGGAATACAGACATTATCAGGGAGAAGACAAGAGCGACTAG
Full Trace Sequence: tgagcttgcagggacaggagaagatttgcagcacagcgcgaaacagagccaggtgctgctgccagcaatttcttgtactgatcgctgccatggccgccgagaaaggggatttggacctgaatggagcaaaacagaataccggaatgtggcttgtcaagctcccaaagtacttggcccagcagtgggcaaaagcaaccggcagaggagaagttggaaagctgagaattgttaaaaatcaaggaaaaacagaggtgtcctttacccttaatgaagaacttgcaagcattcaggatattggaggaaagccagcatcatccttagtcactgcacccagggaacatccgtttctgctacagtctgtggggggacaaactctcacagtgtttactgaaagcttatcaggtcaatctgatgacaaatctgaaaaccgggttatagataaacttgctttggagggtattgtggtgcatcgtgctgagtgtagaccagctgctagtgaaaactacatgcaaatgaagagaaaacagattgaagaatcttccaaaccaaagaggcaatcacaacagatagaaaaggcagtaacgacaaactacagaccagtgtcaaaccatcagtacaatattgagtacgagaagaagaaaaaggatgacggcaagcgagcccgagcagataagcaccaggttttggatatgttgttctctgcatttgaaaaacaccagtactacaacattaaggatctcgtggacattaccaagcaacccgtgagttatctaaaagaaattctgagagacattggaatttacaacatgaaaggaactcacaagaacacatgggagcttaagccggaatacagacattatcagggagaagacaagagcgactagaaaacgccagagccaccgtacaacaacagggaggagccatgcatcacaattccactcaccttgcaccgctggaataatacttctctgtgagctgtgtgtcagtacagtcggcaggggatgtcctgtattatttagtccagggatgtccaacctgcagtcctaaaatagttgctgagactgctggtaactgtaattcataagttgaagtattatattttattaatttcaagcatagtcctattggggctaatcctctggcatttgtactcacacttagcaggaggtttgttccaaacaaccatgtgtgtctgtcatttgcccaaaatttaacatataagtccgggcatttaatgtctatattagatatatctatatatagatatatatagatataatatagtctataaagaggccagcaccacccccacacaccacagtgagcagcagcctaaccccagtgtgaccagcacacagctctaggtacaaatgcctgcgtgtttaatgcatccttaaggataattttacagagtctcacttgagctggaaaaataaaaccttatgtatattttcccctggaatcagtgtaaattccactggattttgttaggcaagtctttattcagccttcaaaaagtatattttcatgttaaccttctttaaactaaagctggttttcattatctctgattgattattttttgtactccagttttgtgtgctctacatttttataacactggttcttaataaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAAEKGDLDLNGAKQNTGMWLVKLPKYLAQQWAKATGRGEVGKLRIVKNQGKTEVSFTLNEELASIQDIGGKPASSLVTAPREHPFLLQSVGGQTLTVFTESLSGQSDDKSENRVIDKLALEGIVVHRAECRPAASENYMQMKRKQIEESSKPKRQSQQIEKAVTTNYRPVSNHQYNIEYEKKKKDDGKRARADKHQVLDMLFSAFEKHQYYNIKDLVDITKQPVSYLKEILRDIGIYNMKGTHKNTWELKPEYRHYQGEDKSD
Donor tissue: neurula