ORFeome > gtse1 – XORFeome 2.0

gtse1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis G-2 and S-phase expressed 1, mRNA (cDNA clone MGC:89498 IMAGE:6992292), complete cds
Gene Symbol: gtse1
Gene ID: 448634
ORF gb_acc: MG133997
ORF ID: 11597

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076976

Library Location

Plate ID: GDExt11015
Well Location: C07

EST Sequences

Clone: MGC:89498 IMAGE:6992292
Trimmed Sequence: ATGCAAGCTGGAGGGGCTTTCACTCTCCTGGCTGATGAGGAGTTTGATTTTGATATATCATTGTCTCCTACAAGTTCTAAAGAGGGCAATGAAGACTGTGATGATGAAGTATTTGTTGGGCCTGTAAGACACAAAGAGAAGTGTGTCAGAGCTTCTATTCAAAGCGGAGAATCAGACAAAGGGAGTCCTTCCCTGTTAAGTGAAGATGTTTCCTGGAGTCCTTTAAGTGGAGATAAATTTGTTGAGATCTTCAAGGAAGCTCATTTAGTTGCACTGCAGCTGGAATGTTTTGCCAGTGATGACCAAAAGGAAGTCCAATCATCTAAGAATGATACAAACCAGTTGGTTGAAAAATTTGTTCAGGAGTCTAAATCAAAACTAAATATTTTTGAAAATCTGGACAATAGCAAAACTCCAGTTGCCCTTAAAAGAGAGACATATTGTGTACAAGACAGTCCATTTACCCAGCTTCCTCCTTCAGTTCAACAAAGACTTGCTGTGTCTGGCAGAGATGGTGAAGTGAGGTCTGCTCTGAATAATACAAACCATACCAGTCCTATGAAAATGCCTATACCAACAAAGGGACTTTCTGTTTCACCACTAGTGCTGAAAAGTAAAGTTGTGCAAGCAAAAAGTACTGTTCCAGTAGCAAATTCTAAAAAAACTGTAAGCCGCTTGCAGCCCATCAAAGCAACCTCTTTGGCAACAAAAACAAATCTCCTTACTATAGAAAAGTCAAAATGTAGTAGAAAGTTGAGCCCAAGTAGGAAGAAACATCTCAGTAGTGCAGGCTCCTCAGAAGATATTTTTTCTGACAAATCCAGTGTTGCATCAGATGTCAGCGATTCTTCGTTCAACAGCAGCATTGCAGGACAAATCAAAAGGACACTTCCAGCCCCAGGCAAGATTGGCCTGAAAAAAACACAGTTTAAAGCTCCAACCAGTGGTGCAAAGTTTAGGAAAAATACATCTTCTTCATCTTCCTCACATTCCAGCATGAATGCCAGTTTAAACTCAAGTGTGTCTGCATCTCCACCTCCTGGGAATGCCAAACTTAACACTTCTCTTAATGTCTCAATGAATGCTTTAAAGCTAAAGTCTAATCAGAGCAGGCTGGGATTAGTTAATCCCTCTGGTGCATCCACCTCCTCTGTGAAAATGAATGTTTCAGAGTTGTCAAAAAGTCGTCTTAAACCAAGCAGTATGGTAAAATCACTTACTGTTGGAAATTGCAATAAGTCATCATCTGTGTCAGTAGCTGTACCAAAGACACCAGTTGGCAAAATACAGAGACAAACCTCTGCACCTAACTTGAACAGGATACCTGCACCAAATAAACCAGAAAGTGCATTAAAGGGCTCATCCTGTACTAAGCCGCAAGCAAAAGTAATGCCTACACCAACAAGCCGTCTCAAGCTGCCTCAGAGAGCTACAGGAGTATCATCGCCTGATCGGTCTGTACTGAAGACATTGCAGCCAACTCGATTAATGTCTTGTGGTGAAATTGGAAGTGGTATAGCTGAAAGCACTCCAGTGAGATCCACACAAGGCACAGTAACCAGCATTGCCCCTGTCACAAAATCTGTTTCTGCTACACCTAGTACAAAGCACATATCTTCCTTGCCTACTCCCCTGAGTCGGAGAACTGCTGCTCTGATGACGCCAAGAACAATCCCAAGATCTATTGCATCTCAGAGGACCGTGCAAGCTTTGCAGAGTTCTACAAAGTCCATTAAGAAGCCTCTTGTGAATGGACCAGAAGAATCTAAAGGAAAAGGGGCAAAAATTACTTCTAGCCCAGGCTCTCCCATTGAAGAAGATTTAGCTTTGGCAAATGTGATTCCTTGTTCTTTAAAGTTCTCTCCTGAAAGCAAAGTTATATCTGTAAATGAAAAAGAAACTTCTAAGTCAATCTGTTCTTCAAACAAAGAGATGTTACTTGTTGATTTTGAAGAGCTAATACATGAAACAGATGCTAAACTGAGAAAACATTCCTCAGCTGGAAGTGATGGTTACCCTCTTATTGACCTTTCCAACACGCCTGAATTGAACAAAATAGTTTTTCCAATAAAACCAGCTATTATTGGTCAGCTTATAGATTTAAGTTCTCCTCTTATCCAGCTGAGTCCTGTACTGAACAAGGAAAATATAGAATTTGATTCTCCGCTCCTGAAGTTTTGA
Full Trace Sequence: ggcttgtttggtgttggtcgggcggattagtggctcgcacctgtgcattaattctacccttttcggacacactcacagccaaacgggtaaacgcagcgagtggtgagatacagatgcgtgaaagactacgtcaccaaaagtaagataaaaacatttgaaaggattatcacaatgcaagctggaggggctttcactctcctggctgatgaggagtttgattttgatatatcattgtctcctacaagttctaaagagggcaatgaagactgtgatgatgaagtatttgttgggcctgtaagacacaaagagaagtgtgtcagagcttctattcaaagcggagaatcagacaaagggagtccttccctgttaagtgaagatgtttcctggagtcctttaagtggagataaatttgttgagatcttcaaggaagctcatttagttgcactgcagctggaatgttttgccagtgatgaccaaaaggaagtccaatcatctaagaatgatacaaaccagttggttgaaaaatttgttcaggagtctaaatcaaaactaaatatttttgaaaatctggacaatagcaaaactccagttgcccttaaaagagagacatattgtgtacaagacagtccatttacccagcttcctccttcagttcaacaaagacttgctgtgtctggcagagatggtgaagtgaggtctgctctgaataatacaaaccataccagtcctatgaaaatgcctataccaacaaagggactttctgtttcaccactagtgctgaaaagtaaagttgtgcaagcaaaaagtactgttccagtagcaaattctaaaaaaactgtaagccgcttgcagcccatcaaagcaacctctttggcaacaaaaacaaatctccttactatagaaaagtcaaaatgtagtagaaagttgagcccaagtaggaagaaacatctcagtagtgcaggctcctcagaagatattttttctgacaaatccagtgttgcatcagatgtcagcgattcttcgttcaacagcagcattgcaggacaaatcaaaaggacacttccagccccaggcaagattggcctgaaaaaaacacagtttaaagctccaaccagtggtgcaaagtttaggaaaaatacatcttcttcatcttcctcacattccagcatgaatgccagtttaaactcaagtgtgtctgcatctccacctcctgggaatgccaaacttaacacttctcttaatgtctcaatgaatgctttaaagctaaagtctaatcagagcaggctgggattagttaatccctctggtgcatccacctcctctgtgaaaatgaatgtttcagagttgtcaaaaagtcgtcttaaaccaagcagtatggtaaaatcacttactgttggaaattgcaataagtcatcatctgtgtcagtagctgtaccaaagacaccagttggcaaaatacagagacaaacctctgcacctaacttgaacaggatacctgcaccaaataaaccagaaagtgcattaaagggctcatcctgtactaagccgcaagcaaaagtaatgcctacaccaacaagccgtctcaagctgcctcagagagctacaggagtatcatcgcctgatcggtctgtactgaagacattgcagccaactcgattaatgtcttgtggtgaaattggaagtggtatagctgaaagcactccagtgagatccacacaaggcacagtaaccagcattgcccctgtcacaaaatctgtttctgctacacctagtacaaagcacatatcttccttgcctactcccctgagtcggagaactgctgctctgatgacgccaagaacaatcccaagatctattgcatctcagaggaccgtgcaagctttgcagagttctacaaagtccattaagaagcctcttgtgaatggaccagaagaatctaaaggaaaaggggcaaaaattacttctagcccaggctctcccattgaagaagatttagctttggcaaatgtgattccttgttctttaaagttctctcctgaaagcaaagttatatctgtaaatgaaaaagaaacttctaagtcaatctgttcttcaaacaaagagatgttacttgttgattttgaagagctaatacatgaaacagatgctaaactgagaaaacattcctcagctggaagtgatggttaccctcttattgacctttccaacacgcctgaattgaacaaaatagtttttccaataaaaccagctattattggtcagcttatagatttaagttctcctcttatccagctgagtcctgtactgaacaaggaaaatatagaatttgattctccgctcctgaagttttgaaaaaccaaatgtttttacatcaatacaaaaacaccgttacctgttttagtgtaataaccattgacgttttaagtgtgagaaacctggtggagtgtgtaaagcatgggccatttttatgccactggaagaaccagtactcctcaatgtttcacatggaaaagatgcacagaatgtacactgcatgaagccccagacttgcatgttttgtcctagggttataatttacagaaaaaggagatgatgtgaggttgcagtgcttttatgcagtgaaattgcctactgactttgcagttaatgttgcttatatgcgcctgaaaataatgctgcattttagatcaatctttgacgcaagggacaaaaaaatgaaattaattggaaatgtctcttttaaaaagaaatccgcctgataactgttatacatgttagtaatgtgttcaattttgtgtaaataaaattaacataattcttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MQAGGAFTLLADEEFDFDISLSPTSSKEGNEDCDDEVFVGPVRHKEKCVRASIQSGESDKGSPSLLSEDVSWSPLSGDKFVEIFKEAHLVALQLECFASDDQKEVQSSKNDTNQLVEKFVQESKSKLNIFENLDNSKTPVALKRETYCVQDSPFTQLPPSVQQRLAVSGRDGEVRSALNNTNHTSPMKMPIPTKGLSVSPLVLKSKVVQAKSTVPVANSKKTVSRLQPIKATSLATKTNLLTIEKSKCSRKLSPSRKKHLSSAGSSEDIFSDKSSVASDVSDSSFNSSIAGQIKRTLPAPGKIGLKKTQFKAPTSGAKFRKNTSSSSSSHSSMNASLNSSVSASPPPGNAKLNTSLNVSMNALKLKSNQSRLGLVNPSGASTSSVKMNVSELSKSRLKPSSMVKSLTVGNCNKSSSVSVAVPKTPVGKIQRQTSAPNLNRIPAPNKPESALKGSSCTKPQAKVMPTPTSRLKLPQRATGVSSPDRSVLKTLQPTRLMSCGEIGSGIAESTPVRSTQGTVTSIAPVTKSVSATPSTKHISSLPTPLSRRTAALMTPRTIPRSIASQRTVQALQSSTKSIKKPLVNGPEESKGKGAKITSSPGSPIEEDLALANVIPCSLKFSPESKVISVNEKETSKSICSSNKEMLLVDFEELIHETDAKLRKHSSAGSDGYPLIDLSNTPELNKIVFPIKPAIIGQLIDLSSPLIQLSPVLNKENIEFDSPLLKF
Donor tissue: neurula